EMAIL THIS PAGE TO A FRIEND

CRTAM

cytotoxic and regulatory T cell molecule

Synonyms: CD355
UniProtKB ID: O95727, Q59EI1, Q6IRX2
Gene ID:
Human(56253) Summary: The CRTAM gene is upregulated in CD4 (see MIM 186940)-positive and CD8 (see CD8A; MIM 186910)-positive T cells and encodes a type I transmembrane protein with V and C1-like Ig domains (Yeh et al., 2008 [PubMed 18329370]
Mouse(54698) cytotoxic and regulatory T cell molecule
Rat(300649) cytotoxic and regulatory T cell molecule
chicken(395342) cytotoxic and regulatory T cell molecule
cow(781864) cytotoxic and regulatory T cell molecule
Horse(100071643) cytotoxic and regulatory T cell molecule
domestic cat(101086672) cytotoxic and regulatory T cell molecule
dog(610296) cytotoxic and regulatory T cell molecule
sheep(101111901) cytotoxic and regulatory T cell molecule
naked mole-rat(101700182) cytotoxic and regulatory T cell molecule
domestic guinea pig(100721718) cytotoxic and regulatory T cell molecule
102 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0645 Human CRTAM / Cytotoxic and Regulatory T-cell Molecule ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019604 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019604 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019604 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019465 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019465 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019465 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU004901 MISSION® esiRNA esiRNA targeting human CRTAM (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019604 Rosetta Predictions human pricing
NM_001106813 Rosetta Predictions rat pricing
NM_019465 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019604 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00352808 predicted 811
2 SASI_Hs02_00352809 predicted 539
3 SASI_Hs02_00352810 predicted 684
4 SASI_Hs02_00352811 predicted 822
5 SASI_Hs02_00352812 predicted 495
6 SASI_Hs02_00352813 predicted 1157
7 SASI_Hs02_00352814 predicted 413
8 SASI_Hs02_00352815 predicted 996
9 SASI_Hs02_00352816 predicted 739
10 SASI_Hs02_00352817 predicted 1069
11 SASI_Hs01_00151302 predicted 351
12 SASI_Hs01_00151303 predicted 1049
13 SASI_Hs01_00151304 predicted 1160
14 SASI_Hs01_00151305 predicted 347
15 SASI_Hs01_00151306 predicted 935
16 SASI_Hs01_00151307 predicted 991
17 SASI_Hs01_00151308 predicted 368
18 SASI_Hs01_00151309 predicted 1155
19 SASI_Hs01_00151310 predicted 1063
20 SASI_Hs01_00151311 predicted 351
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106813 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222658 predicted 607
2 SASI_Rn02_00222659 predicted 387
3 SASI_Rn02_00222660 predicted 599
4 SASI_Rn02_00222661 predicted 838
5 SASI_Rn02_00222662 predicted 817
6 SASI_Rn02_00222663 predicted 312
7 SASI_Rn02_00222664 predicted 408
8 SASI_Rn02_00222665 predicted 301
9 SASI_Rn02_00222666 predicted 1043
10 SASI_Rn02_00222667 predicted 1002
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019465 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00324457 predicted 394
2 SASI_Mm02_00324458 predicted 233
3 SASI_Mm02_00324459 predicted 401
4 SASI_Mm02_00324460 predicted 628
5 SASI_Mm02_00324461 predicted 469
6 SASI_Mm02_00324462 predicted 385
7 SASI_Mm02_00324463 predicted 915
8 SASI_Mm02_00324464 predicted 759
9 SASI_Mm02_00324465 predicted 623
10 SASI_Mm02_00324466 predicted 387
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019604
CRTAM MISSION shRNA Bacterial Glycerol Stock
cytotoxic and regulatory T cell molecule
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000121885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019604.1-494s1c1
Sequence:CCGGGAACGCTCCATGAATTTGAAACTCGAGTTTCAAATTCATGGAGCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019604.1-816s1c1
Sequence:CCGGCGAAGCAAATCCTCAGTATTTCTCGAGAAATACTGAGGATTTGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143742    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019604.1-281s1c1
Sequence:CCGGGCGTGTACAAGTGCTTACATTCTCGAGAATGTAAGCACTTGTACACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142107    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019604.1-933s1c1
Sequence:CCGGGCTGAGGAAAGCACATGTGATCTCGAGATCACATGTGCTTTCCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019604.1-256s1c1
Sequence:CCGGCCTAACGTAACCCTGCAAGATCTCGAGATCTTGCAGGGTTACGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141076    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019604.1-245s1c1
Sequence:CCGGCCATCACTGTGCCTAACGTAACTCGAGTTACGTTAGGCACAGTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141316    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019604.1-722s1c1
Sequence:CCGGCCACCAGTACTGTCTCAGTAACTCGAGTTACTGAGACAGTACTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019604.1-903s1c1
Sequence:CCGGCTTCATCATAGTCCAGCTCTTCTCGAGAAGAGCTGGACTATGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145438    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019604.1-778s1c1
Sequence:CCGGGAGAAAGAACAAACCACTCAACTCGAGTTGAGTGGTTTGTTCTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145354    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019604.1-313s1c1
Sequence:CCGGGTAAGCACAAAGGAAGTGAAACTCGAGTTTCACTTCCTTTGTGCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144195    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019604.1-1085s1c1
Sequence:CCGGCAAAGTTGTACTCAGAAGCAACTCGAGTTGCTTCTGAGTACAACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019604.1-373s1c1
Sequence:CCGGGCTTCAGTTATCAGAAAGCAACTCGAGTTGCTTTCTGATAACTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019604
CRTAM MISSION shRNA shRNA Plasmid DNA
cytotoxic and regulatory T cell molecule
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000121885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019604.1-494s1c1
Sequence:CCGGGAACGCTCCATGAATTTGAAACTCGAGTTTCAAATTCATGGAGCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019604.1-816s1c1
Sequence:CCGGCGAAGCAAATCCTCAGTATTTCTCGAGAAATACTGAGGATTTGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143742    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019604.1-281s1c1
Sequence:CCGGGCGTGTACAAGTGCTTACATTCTCGAGAATGTAAGCACTTGTACACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142107    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019604.1-933s1c1
Sequence:CCGGGCTGAGGAAAGCACATGTGATCTCGAGATCACATGTGCTTTCCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019604.1-256s1c1
Sequence:CCGGCCTAACGTAACCCTGCAAGATCTCGAGATCTTGCAGGGTTACGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141076    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019604.1-245s1c1
Sequence:CCGGCCATCACTGTGCCTAACGTAACTCGAGTTACGTTAGGCACAGTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141316    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019604.1-722s1c1
Sequence:CCGGCCACCAGTACTGTCTCAGTAACTCGAGTTACTGAGACAGTACTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019604.1-903s1c1
Sequence:CCGGCTTCATCATAGTCCAGCTCTTCTCGAGAAGAGCTGGACTATGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145438    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019604.1-778s1c1
Sequence:CCGGGAGAAAGAACAAACCACTCAACTCGAGTTGAGTGGTTTGTTCTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145354    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019604.1-313s1c1
Sequence:CCGGGTAAGCACAAAGGAAGTGAAACTCGAGTTTCACTTCCTTTGTGCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144195    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019604.1-1085s1c1
Sequence:CCGGCAAAGTTGTACTCAGAAGCAACTCGAGTTGCTTCTGAGTACAACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019604.1-373s1c1
Sequence:CCGGGCTTCAGTTATCAGAAAGCAACTCGAGTTGCTTTCTGATAACTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019604
CRTAM MISSION shRNA Lentiviral Transduction Particles
cytotoxic and regulatory T cell molecule
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000121885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019604.1-494s1c1
Sequence:CCGGGAACGCTCCATGAATTTGAAACTCGAGTTTCAAATTCATGGAGCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019604.1-816s1c1
Sequence:CCGGCGAAGCAAATCCTCAGTATTTCTCGAGAAATACTGAGGATTTGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143742    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019604.1-281s1c1
Sequence:CCGGGCGTGTACAAGTGCTTACATTCTCGAGAATGTAAGCACTTGTACACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142107    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019604.1-933s1c1
Sequence:CCGGGCTGAGGAAAGCACATGTGATCTCGAGATCACATGTGCTTTCCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019604.1-256s1c1
Sequence:CCGGCCTAACGTAACCCTGCAAGATCTCGAGATCTTGCAGGGTTACGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141076    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019604.1-245s1c1
Sequence:CCGGCCATCACTGTGCCTAACGTAACTCGAGTTACGTTAGGCACAGTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141316    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019604.1-722s1c1
Sequence:CCGGCCACCAGTACTGTCTCAGTAACTCGAGTTACTGAGACAGTACTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019604.1-903s1c1
Sequence:CCGGCTTCATCATAGTCCAGCTCTTCTCGAGAAGAGCTGGACTATGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145438    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019604.1-778s1c1
Sequence:CCGGGAGAAAGAACAAACCACTCAACTCGAGTTGAGTGGTTTGTTCTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145354    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019604.1-313s1c1
Sequence:CCGGGTAAGCACAAAGGAAGTGAAACTCGAGTTTCACTTCCTTTGTGCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144195    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019604.1-1085s1c1
Sequence:CCGGCAAAGTTGTACTCAGAAGCAACTCGAGTTGCTTCTGAGTACAACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019604.1-373s1c1
Sequence:CCGGGCTTCAGTTATCAGAAAGCAACTCGAGTTGCTTTCTGATAACTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019465
CRTAM MISSION shRNA Bacterial Glycerol Stock
cytotoxic and regulatory T cell molecule
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193075    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019465.1-977s1c2
Sequence:CCGGCTCTAGAAAGTTACAGATCAACTCGAGTTGATCTGTAACTTTCTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019465.1-487s1c1
Sequence:CCGGGAACTCCACCATGAATTTGAACTCGAGTTCAAATTCATGGTGGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019465.1-961s1c1
Sequence:CCGGGAAATTTCAGAGCAAGCTCTACTCGAGTAGAGCTTGCTCTGAAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019465.1-1065s1c1
Sequence:CCGGGAACTACATCACGCAGTTATACTCGAGTATAACTGCGTGATGTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019465.1-214s1c1
Sequence:CCGGCTTCACCATTCAGCTACACAACTCGAGTTGTGTAGCTGAATGGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019465.1-104s1c1
Sequence:CCGGCGTGTGTTACTTCTCAGACAACTCGAGTTGTCTGAGAAGTAACACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000445987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019465.2-567s21c1
Sequence:CCGGCTCAACCGTGCACTGCATTATCTCGAGATAATGCAGTGCACGGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019465.2-1059s21c1
Sequence:CCGGGAACTACATCACGCGGTTATACTCGAGTATAACCGCGTGATGTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019465
CRTAM MISSION shRNA shRNA Plasmid DNA
cytotoxic and regulatory T cell molecule
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193075    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019465.1-977s1c2
Sequence:CCGGCTCTAGAAAGTTACAGATCAACTCGAGTTGATCTGTAACTTTCTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019465.1-487s1c1
Sequence:CCGGGAACTCCACCATGAATTTGAACTCGAGTTCAAATTCATGGTGGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019465.1-961s1c1
Sequence:CCGGGAAATTTCAGAGCAAGCTCTACTCGAGTAGAGCTTGCTCTGAAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019465.1-1065s1c1
Sequence:CCGGGAACTACATCACGCAGTTATACTCGAGTATAACTGCGTGATGTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019465.1-214s1c1
Sequence:CCGGCTTCACCATTCAGCTACACAACTCGAGTTGTGTAGCTGAATGGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019465.1-104s1c1
Sequence:CCGGCGTGTGTTACTTCTCAGACAACTCGAGTTGTCTGAGAAGTAACACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000445987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019465.2-567s21c1
Sequence:CCGGCTCAACCGTGCACTGCATTATCTCGAGATAATGCAGTGCACGGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019465.2-1059s21c1
Sequence:CCGGGAACTACATCACGCGGTTATACTCGAGTATAACCGCGTGATGTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019465
CRTAM MISSION shRNA Lentiviral Transduction Particles
cytotoxic and regulatory T cell molecule
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193075    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019465.1-977s1c2
Sequence:CCGGCTCTAGAAAGTTACAGATCAACTCGAGTTGATCTGTAACTTTCTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019465.1-487s1c1
Sequence:CCGGGAACTCCACCATGAATTTGAACTCGAGTTCAAATTCATGGTGGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019465.1-961s1c1
Sequence:CCGGGAAATTTCAGAGCAAGCTCTACTCGAGTAGAGCTTGCTCTGAAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019465.1-1065s1c1
Sequence:CCGGGAACTACATCACGCAGTTATACTCGAGTATAACTGCGTGATGTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019465.1-214s1c1
Sequence:CCGGCTTCACCATTCAGCTACACAACTCGAGTTGTGTAGCTGAATGGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019465.1-104s1c1
Sequence:CCGGCGTGTGTTACTTCTCAGACAACTCGAGTTGTCTGAGAAGTAACACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000445987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019465.2-567s21c1
Sequence:CCGGCTCAACCGTGCACTGCATTATCTCGAGATAATGCAGTGCACGGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019465.2-1059s21c1
Sequence:CCGGGAACTACATCACGCGGTTATACTCGAGTATAACCGCGTGATGTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks