EMAIL THIS PAGE TO A FRIEND

CRTAP

cartilage associated protein

81 Gene Product Result for
Synonyms: CASP LEPREL3 OI7
UniProtKB ID: O75718, B2RBL6
Gene ID:
Human(10491) Summary: The protein encoded by this gene is similar to the chicken and mouse CRTAP genes. The encoded protein is a scaffolding protein that may influence the activity of at least one member of the cytohesin/ARNO family in response to specific cellular stimuli. Defects in this gene are associated with osteogenesis imperfecta, a connective tissue disorder characterized by bone fragility and low bone mass. [provided by RefSeq, Jul 2008]
Mouse(56693) cartilage associated protein
Rat(363158) cartilage associated protein
domestic guinea pig(100721078) cartilage associated protein
naked mole-rat(101714225) cartilage associated protein
sheep(101113179) cartilage associated protein
Domestic Rabbit(100339498) cartilage associated protein
Zebrafish(406626) cartilage associated protein
cow(540924) cartilage associated protein
domestic cat(101097013) cartilage associated protein
dog(485577) cartilage associated protein
chicken(395992) cartilage associated protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006371 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006371 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006371 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019922 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019922 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019922 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006371 Rosetta Predictions human pricing
NM_001108785 Rosetta Predictions rat pricing
NM_019922 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006371 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00096624 predicted 637
2 SASI_Hs01_00096625 predicted 663
3 SASI_Hs01_00096626 predicted 1078
4 SASI_Hs01_00096627 predicted 897
5 SASI_Hs01_00096628 predicted 554
6 SASI_Hs01_00096629 predicted 1030
7 SASI_Hs01_00096630 predicted 644
8 SASI_Hs01_00096631 predicted 722
9 SASI_Hs01_00096632 predicted 917
10 SASI_Hs01_00096633 predicted 1271
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108785 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242045 predicted 501
2 SASI_Rn02_00242046 predicted 595
3 SASI_Rn02_00242047 predicted 248
4 SASI_Rn02_00242048 predicted 574
5 SASI_Rn02_00242049 predicted 302
6 SASI_Rn02_00242050 predicted 479
7 SASI_Rn02_00242051 predicted 575
8 SASI_Rn02_00242052 predicted 571
9 SASI_Rn02_00242053 predicted 514
10 SASI_Rn02_00242054 predicted 274
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019922 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00049613 predicted 671
2 SASI_Mm01_00049614 predicted 970
3 SASI_Mm01_00049615 predicted 613
4 SASI_Mm01_00049617 predicted 719
5 SASI_Mm01_00049618 predicted 951
6 SASI_Mm02_00325199 predicted 1409
7 SASI_Mm01_00049619 predicted 961
8 SASI_Mm01_00049620 predicted 863
9 SASI_Mm01_00049621 predicted 1138
10 SASI_Mm01_00049622 predicted 979
11 SASI_Mm01_00049616 predicted 974
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006371
VALIDATED
CRTAP MISSION shRNA Bacterial Glycerol Stock
cartilage associated protein
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006371.4-900s21c1
Sequence:CCGGCCTTTCCATAGCAGATCATTACTCGAGTAATGATCTGCTATGGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421362    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006371.4-1517s21c1
Sequence:CCGGTCATGTTCACACCTATCTTTCCTCGAGGAAAGATAGGTGTGAACATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412545    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006371.4-1356s21c1
Sequence:CCGGGCGTTCAGGAAACACAGATTCCTCGAGGAATCTGTGTTTCCTGAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412372    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006371.4-1425s21c1
Sequence:CCGGCTTTACTCTCCAAAGTGAAAGCTCGAGCTTTCACTTTGGAGAGTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006371.4-977s21c1
Sequence:CCGGGAGGCTATCCGGTTGAGAAATCTCGAGATTTCTCAACCGGATAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006371.4-1271s21c1
Sequence:CCGGAGGGAGAAGTTGTGGAATATGCTCGAGCATATTCCACAACTTCTCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179830    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006371.2-1077s1c1
Sequence:CCGGCCTGAAGCAGTTCAGTTCTTTCTCGAGAAAGAACTGAACTGCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006371.2-533s1c1
Sequence:CCGGGCATCCTGATGACGAAATGATCTCGAGATCATTTCGTCATCAGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181025    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006371.2-89s1c1
Sequence:CCGGCCAATACGAACGCTACAGCTTCTCGAGAAGCTGTAGCGTTCGTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178729    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006371.2-877s1c1
Sequence:CCGGCGGTTGAGAAATTTGTGGCTACTCGAGTAGCCACAAATTTCTCAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147844    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006371.2-623s1c1
Sequence:CCGGGTCATATGAAAGCCTGTTCATCTCGAGATGAACAGGCTTTCATATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146998    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006371.2-470s1c1
Sequence:CCGGCGCTTACTTCAAGGCAAATAACTCGAGTTATTTGCCTTGAAGTAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006371.2-597s1c1
Sequence:CCGGGACTACATTAAAGACCTGGAACTCGAGTTCCAGGTCTTTAATGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006371
VALIDATED
CRTAP MISSION shRNA shRNA Plasmid DNA
cartilage associated protein
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006371.4-900s21c1
Sequence:CCGGCCTTTCCATAGCAGATCATTACTCGAGTAATGATCTGCTATGGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421362    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006371.4-1517s21c1
Sequence:CCGGTCATGTTCACACCTATCTTTCCTCGAGGAAAGATAGGTGTGAACATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412545    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006371.4-1356s21c1
Sequence:CCGGGCGTTCAGGAAACACAGATTCCTCGAGGAATCTGTGTTTCCTGAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412372    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006371.4-1425s21c1
Sequence:CCGGCTTTACTCTCCAAAGTGAAAGCTCGAGCTTTCACTTTGGAGAGTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006371.4-977s21c1
Sequence:CCGGGAGGCTATCCGGTTGAGAAATCTCGAGATTTCTCAACCGGATAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006371.4-1271s21c1
Sequence:CCGGAGGGAGAAGTTGTGGAATATGCTCGAGCATATTCCACAACTTCTCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179830    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006371.2-1077s1c1
Sequence:CCGGCCTGAAGCAGTTCAGTTCTTTCTCGAGAAAGAACTGAACTGCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006371.2-533s1c1
Sequence:CCGGGCATCCTGATGACGAAATGATCTCGAGATCATTTCGTCATCAGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181025    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006371.2-89s1c1
Sequence:CCGGCCAATACGAACGCTACAGCTTCTCGAGAAGCTGTAGCGTTCGTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178729    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006371.2-877s1c1
Sequence:CCGGCGGTTGAGAAATTTGTGGCTACTCGAGTAGCCACAAATTTCTCAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147844    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006371.2-623s1c1
Sequence:CCGGGTCATATGAAAGCCTGTTCATCTCGAGATGAACAGGCTTTCATATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146998    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006371.2-470s1c1
Sequence:CCGGCGCTTACTTCAAGGCAAATAACTCGAGTTATTTGCCTTGAAGTAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006371.2-597s1c1
Sequence:CCGGGACTACATTAAAGACCTGGAACTCGAGTTCCAGGTCTTTAATGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006371
VALIDATED
CRTAP MISSION shRNA Lentiviral Transduction Particles
cartilage associated protein
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006371.4-900s21c1
Sequence:CCGGCCTTTCCATAGCAGATCATTACTCGAGTAATGATCTGCTATGGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421362    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006371.4-1517s21c1
Sequence:CCGGTCATGTTCACACCTATCTTTCCTCGAGGAAAGATAGGTGTGAACATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412545    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006371.4-1356s21c1
Sequence:CCGGGCGTTCAGGAAACACAGATTCCTCGAGGAATCTGTGTTTCCTGAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412372    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006371.4-1425s21c1
Sequence:CCGGCTTTACTCTCCAAAGTGAAAGCTCGAGCTTTCACTTTGGAGAGTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006371.4-977s21c1
Sequence:CCGGGAGGCTATCCGGTTGAGAAATCTCGAGATTTCTCAACCGGATAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006371.4-1271s21c1
Sequence:CCGGAGGGAGAAGTTGTGGAATATGCTCGAGCATATTCCACAACTTCTCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179830    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006371.2-1077s1c1
Sequence:CCGGCCTGAAGCAGTTCAGTTCTTTCTCGAGAAAGAACTGAACTGCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006371.2-533s1c1
Sequence:CCGGGCATCCTGATGACGAAATGATCTCGAGATCATTTCGTCATCAGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181025    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006371.2-89s1c1
Sequence:CCGGCCAATACGAACGCTACAGCTTCTCGAGAAGCTGTAGCGTTCGTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178729    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006371.2-877s1c1
Sequence:CCGGCGGTTGAGAAATTTGTGGCTACTCGAGTAGCCACAAATTTCTCAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147844    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006371.2-623s1c1
Sequence:CCGGGTCATATGAAAGCCTGTTCATCTCGAGATGAACAGGCTTTCATATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146998    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006371.2-470s1c1
Sequence:CCGGCGCTTACTTCAAGGCAAATAACTCGAGTTATTTGCCTTGAAGTAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006371.2-597s1c1
Sequence:CCGGGACTACATTAAAGACCTGGAACTCGAGTTCCAGGTCTTTAATGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019922
CRTAP MISSION shRNA Bacterial Glycerol Stock
cartilage associated protein
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000345850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019922.2-1233s21c1
Sequence:CCGGGCTCAGGAACACCTAATGGATCTCGAGATCCATTAGGTGTTCCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019922.2-1020s21c1
Sequence:CCGGGCGTATTACAAGTTGAATGATCTCGAGATCATTCAACTTGTAATACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019922.2-1005s21c1
Sequence:CCGGCACTATTTACAGTTTGCGTATCTCGAGATACGCAAACTGTAAATAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019922.2-644s21c1
Sequence:CCGGCGAGATGATGAAGAGAAACATCTCGAGATGTTTCTCTTCATCATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019922.2-548s21c1
Sequence:CCGGGCCCTACAAGTTTCTGCAGTTCTCGAGAACTGCAGAAACTTGTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216639    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019922.1-1062s1c1
Sequence:CCGGCAACAGAACCTGGTGTACTATCTCGAGATAGTACACCAGGTTCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019922.1-506s1c1
Sequence:CCGGGCCCTACAAGTTTCTGCAGTTCTCGAGAACTGCAGAAACTTGTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019922.1-1191s1c1
Sequence:CCGGGCTCAGGAACACCTAATGGATCTCGAGATCCATTAGGTGTTCCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019922.1-963s1c1
Sequence:CCGGCACTATTTACAGTTTGCGTATCTCGAGATACGCAAACTGTAAATAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019922.1-978s1c1
Sequence:CCGGGCGTATTACAAGTTGAATGATCTCGAGATCATTCAACTTGTAATACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019922.1-602s1c1
Sequence:CCGGCGAGATGATGAAGAGAAACATCTCGAGATGTTTCTCTTCATCATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197500    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019922.1-1136s1c1
Sequence:CCGGCGAAGCAGTTCAGTTCTTTAACTCGAGTTAAAGAACTGAACTGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019922
CRTAP MISSION shRNA shRNA Plasmid DNA
cartilage associated protein
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000345850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019922.2-1233s21c1
Sequence:CCGGGCTCAGGAACACCTAATGGATCTCGAGATCCATTAGGTGTTCCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019922.2-1020s21c1
Sequence:CCGGGCGTATTACAAGTTGAATGATCTCGAGATCATTCAACTTGTAATACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019922.2-1005s21c1
Sequence:CCGGCACTATTTACAGTTTGCGTATCTCGAGATACGCAAACTGTAAATAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019922.2-644s21c1
Sequence:CCGGCGAGATGATGAAGAGAAACATCTCGAGATGTTTCTCTTCATCATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019922.2-548s21c1
Sequence:CCGGGCCCTACAAGTTTCTGCAGTTCTCGAGAACTGCAGAAACTTGTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216639    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019922.1-1062s1c1
Sequence:CCGGCAACAGAACCTGGTGTACTATCTCGAGATAGTACACCAGGTTCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019922.1-506s1c1
Sequence:CCGGGCCCTACAAGTTTCTGCAGTTCTCGAGAACTGCAGAAACTTGTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019922.1-1191s1c1
Sequence:CCGGGCTCAGGAACACCTAATGGATCTCGAGATCCATTAGGTGTTCCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019922.1-963s1c1
Sequence:CCGGCACTATTTACAGTTTGCGTATCTCGAGATACGCAAACTGTAAATAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019922.1-978s1c1
Sequence:CCGGGCGTATTACAAGTTGAATGATCTCGAGATCATTCAACTTGTAATACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019922.1-602s1c1
Sequence:CCGGCGAGATGATGAAGAGAAACATCTCGAGATGTTTCTCTTCATCATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197500    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019922.1-1136s1c1
Sequence:CCGGCGAAGCAGTTCAGTTCTTTAACTCGAGTTAAAGAACTGAACTGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019922
CRTAP MISSION shRNA Lentiviral Transduction Particles
cartilage associated protein
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000345850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019922.2-1233s21c1
Sequence:CCGGGCTCAGGAACACCTAATGGATCTCGAGATCCATTAGGTGTTCCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019922.2-1020s21c1
Sequence:CCGGGCGTATTACAAGTTGAATGATCTCGAGATCATTCAACTTGTAATACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019922.2-1005s21c1
Sequence:CCGGCACTATTTACAGTTTGCGTATCTCGAGATACGCAAACTGTAAATAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019922.2-644s21c1
Sequence:CCGGCGAGATGATGAAGAGAAACATCTCGAGATGTTTCTCTTCATCATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019922.2-548s21c1
Sequence:CCGGGCCCTACAAGTTTCTGCAGTTCTCGAGAACTGCAGAAACTTGTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216639    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019922.1-1062s1c1
Sequence:CCGGCAACAGAACCTGGTGTACTATCTCGAGATAGTACACCAGGTTCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019922.1-506s1c1
Sequence:CCGGGCCCTACAAGTTTCTGCAGTTCTCGAGAACTGCAGAAACTTGTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019922.1-1191s1c1
Sequence:CCGGGCTCAGGAACACCTAATGGATCTCGAGATCCATTAGGTGTTCCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019922.1-963s1c1
Sequence:CCGGCACTATTTACAGTTTGCGTATCTCGAGATACGCAAACTGTAAATAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019922.1-978s1c1
Sequence:CCGGGCGTATTACAAGTTGAATGATCTCGAGATCATTCAACTTGTAATACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019922.1-602s1c1
Sequence:CCGGCGAGATGATGAAGAGAAACATCTCGAGATGTTTCTCTTCATCATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197500    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019922.1-1136s1c1
Sequence:CCGGCGAAGCAGTTCAGTTCTTTAACTCGAGTTAAAGAACTGAACTGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks