EMAIL THIS PAGE TO A FRIEND

CRTC1

CREB regulated transcription coactivator 1

72 Gene Product Result for
Synonyms: MECT1 TORC-1 TORC1 WAMTP1
Gene ID:
Mouse(382056) CREB regulated transcription coactivator 1
Rat(684527) CREB regulated transcription coactivator 1
Zebrafish(571344) CREB regulated transcription coactivator 1
chicken(771015) CREB regulated transcription coactivator 1
domestic cat(101095803) CREB regulated transcription coactivator 1
cow(510465) CREB regulated transcription coactivator 1
dog(100684638) CREB regulated transcription coactivator 1
naked mole-rat(101702435) CREB regulated transcription coactivator 1
domestic guinea pig(100713342) CREB regulated transcription coactivator 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA022035 Anti-CRTC1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution rat, mouse, human
immunofluorescence, immunohistochemistry, western blot pricing
SAB5300123 Monoclonal Anti-CRTC1 antibody produced in mouse clone 1B5, ascites fluid human
ELISA, flow cytometry, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004062 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001004062 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001004062 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015321 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015321 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015321 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU154201 MISSION® esiRNA esiRNA targeting mouse Crtc1 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098482 Rosetta Predictions human pricing
NM_015321 Rosetta Predictions human pricing
NM_025021 Rosetta Predictions human pricing
NM_001047115 Rosetta Predictions rat pricing
NM_001004062 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098482 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318969 predicted 667
2 SASI_Hs02_00318970 predicted 703
3 SASI_Hs02_00318971 predicted 784
4 SASI_Hs02_00318972 predicted 1594
5 SASI_Hs02_00318973 predicted 619
6 SASI_Hs02_00318974 predicted 1515
7 SASI_Hs02_00318975 predicted 100
8 SASI_Hs02_00318976 predicted 1645
9 SASI_Hs02_00318977 predicted 93
10 SASI_Hs02_00318978 predicted 314
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015321 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00203373 predicted 622
2 SASI_Hs01_00203374 predicted 654
3 SASI_Hs02_00347591 predicted 740
4 SASI_Hs02_00347592 predicted 1540
5 SASI_Hs01_00203371 predicted 574
6 SASI_Hs01_00203375 predicted 652
7 SASI_Hs02_00347593 predicted 1464
8 SASI_Hs02_00347594 predicted 106
9 SASI_Hs02_00347595 predicted 1601
10 SASI_Hs02_00347596 predicted 92
11 SASI_Hs01_00203372 predicted 512
12 SASI_Hs01_00203376 predicted 540
13 SASI_Hs01_00203377 predicted 628
14 SASI_Hs01_00203378 predicted 540
15 SASI_Hs01_00203379 predicted 590
16 SASI_Hs01_00203380 predicted 500
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025021 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00176220 predicted 584
2 SASI_Hs01_00176221 predicted 581
3 SASI_Hs01_00176222 predicted 623
4 SASI_Hs01_00176223 predicted 666
5 SASI_Hs01_00176224 predicted 663
6 SASI_Hs01_00176225 predicted 601
7 SASI_Hs01_00176226 predicted 689
8 SASI_Hs01_00176227 predicted 607
9 SASI_Hs01_00176228 predicted 654
10 SASI_Hs01_00176229 predicted 566
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047115 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00206065 predicted 282
2 SASI_Rn02_00206066 predicted 1555
3 SASI_Rn02_00206067 predicted 1636
4 SASI_Rn02_00206068 predicted 1006
5 SASI_Rn02_00206069 predicted 692
6 SASI_Rn02_00206070 predicted 533
7 SASI_Rn02_00206071 predicted 1538
8 SASI_Rn02_00206072 predicted 215
9 SASI_Rn02_00206073 predicted 1440
10 SASI_Rn02_00206074 predicted 980
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004062 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00186925 predicted 1820
2 SASI_Mm01_00186927 predicted 2005
3 SASI_Mm01_00186928 predicted 2308
4 SASI_Mm01_00186929 predicted 2334
5 SASI_Mm01_00186930 predicted 1514
6 SASI_Mm01_00186931 predicted 1000
7 SASI_Mm01_00186932 predicted 1703
8 SASI_Mm01_00186933 predicted 2315
9 SASI_Mm01_00186934 predicted 1457
10 SASI_Mm02_00286441 predicted 712
11 SASI_Mm01_00186926 predicted 546
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004062
CRTC1 MISSION shRNA Bacterial Glycerol Stock
CREB regulated transcription coactivator 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175746    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004062.1-1521s1c1
Sequence:CCGGGCAGTTCAACATGATGGAGAACTCGAGTTCTCCATCATGTTGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173774    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004062.1-212s1c1
Sequence:CCGGCCAACGTGAACCAGATTGGAACTCGAGTTCCAATCTGGTTCACGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004062.2-1769s21c1
Sequence:CCGGTTGATTCAGACCATCAGTTTCCTCGAGGAAACTGATGGTCTGAATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242285    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001004062.2-3977s21c1
Sequence:CCGGATAGGTCACCTGTCCGATAATCTCGAGATTATCGGACAGGTGACCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217869    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004062.2-3750s1c1
Sequence:CCGGGAGTGCATGTAGCTGTATTAACTCGAGTTAATACAGCTACATGCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004062.2-310s21c1
Sequence:CCGGGGGCTTGTGGACAGAGTATATCTCGAGATATACTCTGTCCACAAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004062.2-539s21c1
Sequence:CCGGCGCACCAGAAGAGAGTCTTACCTCGAGGTAAGACTCTCTTCTGGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004062.2-1571s21c1
Sequence:CCGGCGGGCTCCACACTCAACTATTCTCGAGAATAGTTGAGTGTGGAGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004062
CRTC1 MISSION shRNA shRNA Plasmid DNA
CREB regulated transcription coactivator 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175746    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004062.1-1521s1c1
Sequence:CCGGGCAGTTCAACATGATGGAGAACTCGAGTTCTCCATCATGTTGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173774    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004062.1-212s1c1
Sequence:CCGGCCAACGTGAACCAGATTGGAACTCGAGTTCCAATCTGGTTCACGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004062.2-1769s21c1
Sequence:CCGGTTGATTCAGACCATCAGTTTCCTCGAGGAAACTGATGGTCTGAATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242285    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001004062.2-3977s21c1
Sequence:CCGGATAGGTCACCTGTCCGATAATCTCGAGATTATCGGACAGGTGACCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217869    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004062.2-3750s1c1
Sequence:CCGGGAGTGCATGTAGCTGTATTAACTCGAGTTAATACAGCTACATGCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004062.2-310s21c1
Sequence:CCGGGGGCTTGTGGACAGAGTATATCTCGAGATATACTCTGTCCACAAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004062.2-539s21c1
Sequence:CCGGCGCACCAGAAGAGAGTCTTACCTCGAGGTAAGACTCTCTTCTGGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004062.2-1571s21c1
Sequence:CCGGCGGGCTCCACACTCAACTATTCTCGAGAATAGTTGAGTGTGGAGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004062
CRTC1 MISSION shRNA Lentiviral Transduction Particles
CREB regulated transcription coactivator 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175746    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004062.1-1521s1c1
Sequence:CCGGGCAGTTCAACATGATGGAGAACTCGAGTTCTCCATCATGTTGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173774    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004062.1-212s1c1
Sequence:CCGGCCAACGTGAACCAGATTGGAACTCGAGTTCCAATCTGGTTCACGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004062.2-1769s21c1
Sequence:CCGGTTGATTCAGACCATCAGTTTCCTCGAGGAAACTGATGGTCTGAATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242285    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001004062.2-3977s21c1
Sequence:CCGGATAGGTCACCTGTCCGATAATCTCGAGATTATCGGACAGGTGACCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217869    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004062.2-3750s1c1
Sequence:CCGGGAGTGCATGTAGCTGTATTAACTCGAGTTAATACAGCTACATGCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004062.2-310s21c1
Sequence:CCGGGGGCTTGTGGACAGAGTATATCTCGAGATATACTCTGTCCACAAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004062.2-539s21c1
Sequence:CCGGCGCACCAGAAGAGAGTCTTACCTCGAGGTAAGACTCTCTTCTGGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004062.2-1571s21c1
Sequence:CCGGCGGGCTCCACACTCAACTATTCTCGAGAATAGTTGAGTGTGGAGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015321
CRTC1 MISSION shRNA Bacterial Glycerol Stock
CREB regulated transcription coactivator 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118892    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015321.1-2013s1c1
Sequence:CCGGCGAGCTTGTGATTCTGAGCTTCTCGAGAAGCTCAGAATCACAAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015321.1-152s1c1
Sequence:CCGGGCTCCAGAAATCCCAGTACCTCTCGAGAGGTACTGGGATTTCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015321.1-1403s1c1
Sequence:CCGGGCCAGTCTCCAATCAAGGCTTCTCGAGAAGCCTTGATTGGAGACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015321.1-1478s1c1
Sequence:CCGGCGCGTACTATGAGCAGCAGATCTCGAGATCTGCTGCTCATAGTACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015321.1-1735s1c1
Sequence:CCGGGCCTCTCTAAAGAACTGACCACTCGAGTGGTCAGTTCTTTAGAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015321.2-1853s21c1
Sequence:CCGGTTCGACTCCGACAGCCAGTTTCTCGAGAAACTGGCTGTCGGAGTCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015321.2-648s21c1
Sequence:CCGGGAATGGAAGAGACCACATCAGCTCGAGCTGATGTGGTCTCTTCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015321.2-623s21c1
Sequence:CCGGAGAGTCTTACTGTTAACAGTCCTCGAGGACTGTTAACAGTAAGACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015321
CRTC1 MISSION shRNA shRNA Plasmid DNA
CREB regulated transcription coactivator 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118892    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015321.1-2013s1c1
Sequence:CCGGCGAGCTTGTGATTCTGAGCTTCTCGAGAAGCTCAGAATCACAAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015321.1-152s1c1
Sequence:CCGGGCTCCAGAAATCCCAGTACCTCTCGAGAGGTACTGGGATTTCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015321.1-1403s1c1
Sequence:CCGGGCCAGTCTCCAATCAAGGCTTCTCGAGAAGCCTTGATTGGAGACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015321.1-1478s1c1
Sequence:CCGGCGCGTACTATGAGCAGCAGATCTCGAGATCTGCTGCTCATAGTACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015321.1-1735s1c1
Sequence:CCGGGCCTCTCTAAAGAACTGACCACTCGAGTGGTCAGTTCTTTAGAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015321.2-1853s21c1
Sequence:CCGGTTCGACTCCGACAGCCAGTTTCTCGAGAAACTGGCTGTCGGAGTCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015321.2-648s21c1
Sequence:CCGGGAATGGAAGAGACCACATCAGCTCGAGCTGATGTGGTCTCTTCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015321.2-623s21c1
Sequence:CCGGAGAGTCTTACTGTTAACAGTCCTCGAGGACTGTTAACAGTAAGACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015321
CRTC1 MISSION shRNA Lentiviral Transduction Particles
CREB regulated transcription coactivator 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118892    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015321.1-2013s1c1
Sequence:CCGGCGAGCTTGTGATTCTGAGCTTCTCGAGAAGCTCAGAATCACAAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015321.1-152s1c1
Sequence:CCGGGCTCCAGAAATCCCAGTACCTCTCGAGAGGTACTGGGATTTCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015321.1-1403s1c1
Sequence:CCGGGCCAGTCTCCAATCAAGGCTTCTCGAGAAGCCTTGATTGGAGACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015321.1-1478s1c1
Sequence:CCGGCGCGTACTATGAGCAGCAGATCTCGAGATCTGCTGCTCATAGTACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015321.1-1735s1c1
Sequence:CCGGGCCTCTCTAAAGAACTGACCACTCGAGTGGTCAGTTCTTTAGAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015321.2-1853s21c1
Sequence:CCGGTTCGACTCCGACAGCCAGTTTCTCGAGAAACTGGCTGTCGGAGTCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015321.2-648s21c1
Sequence:CCGGGAATGGAAGAGACCACATCAGCTCGAGCTGATGTGGTCTCTTCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015321.2-623s21c1
Sequence:CCGGAGAGTCTTACTGTTAACAGTCCTCGAGGACTGTTAACAGTAAGACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks