EMAIL THIS PAGE TO A FRIEND

CRTC2

CREB regulated transcription coactivator 2

85 Gene Product Result for
Synonyms: TORC-2 TORC2
UniProtKB ID: Q53ET0, Q6UUV8, Q7Z3X7
Gene ID:
Human(200186) Summary: This gene encodes a member of the transducers of regulated cAMP response element-binding protein activity family of transcription coactivators. These proteins promote the transcription of genes targeted by the cAMP response element-binding protein, and therefore play an important role in many cellular processes. Under basal conditions the encoded protein is phosphorylated by AMP-activated protein kinase or the salt-inducible kinases and is sequestered in the cytoplasm. Upon activation by elevated cAMP or calcium, the encoded protein translocates to the nucleus and increases target gene expression. Single nucleotide polymorphisms in this gene may increase the risk of type 2 diabetes. A pseudogene of this gene is located on the long arm of chromosome 5. [provided by RefSeq, Dec 2010]
Mouse(74343) CREB regulated transcription coactivator 2
Rat(310615) CREB regulated transcription coactivator 2
domestic guinea pig(100727423) CREB regulated transcription coactivator 2
naked mole-rat(101709168) CREB regulated transcription coactivator 2
sheep(101102117) CREB regulated transcription coactivator 2
cow(540959) CREB regulated transcription coactivator 2
Horse(100056571) CREB regulated transcription coactivator 2
domestic cat(101101104) CREB regulated transcription coactivator 2
dog(612305) CREB regulated transcription coactivator 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028881 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028881 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028881 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_181715 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181715 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181715 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181715 Rosetta Predictions human pricing
NM_001033895 Rosetta Predictions rat pricing
NM_028881 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181715 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00132619 predicted 1652
2 SASI_Hs01_00132620 predicted 423
3 SASI_Hs01_00132621 predicted 434
4 SASI_Hs01_00132622 predicted 2063
5 SASI_Hs01_00132623 predicted 812
6 SASI_Hs01_00132624 predicted 437
7 SASI_Hs01_00132625 predicted 244
8 SASI_Hs01_00132626 predicted 1859
9 SASI_Hs01_00132627 predicted 705
10 SASI_Hs01_00132628 predicted 257
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033895 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00081690 predicted 1367
2 SASI_Rn01_00081691 predicted 670
3 SASI_Rn01_00081692 predicted 364
4 SASI_Rn01_00081693 predicted 384
5 SASI_Rn01_00081694 predicted 261
6 SASI_Rn01_00081695 predicted 551
7 SASI_Rn01_00081696 predicted 384
8 SASI_Rn01_00081697 predicted 378
9 SASI_Rn01_00081698 predicted 932
10 SASI_Rn01_00081699 predicted 917
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028881 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00075471 predicted 795
2 SASI_Mm01_00075472 predicted 293
3 SASI_Mm01_00075473 predicted 2115
4 SASI_Mm01_00075474 predicted 498
5 SASI_Mm01_00075475 predicted 379
6 SASI_Mm02_00334565 predicted 896
7 SASI_Mm01_00075476 predicted 1064
8 SASI_Mm01_00075477 predicted 480
9 SASI_Mm01_00075478 predicted 1039
10 SASI_Mm01_00075479 predicted 318
11 SASI_Mm01_00075480 predicted 1057
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028881
VALIDATED
CRTC2 MISSION shRNA Bacterial Glycerol Stock
CREB regulated transcription coactivator 2
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297698    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028881.1-2460s21c1
Sequence:CCGGAGCAAGGTGTAGAGGGAAATCCTCGAGGATTTCCCTCTACACCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028881.1-751s21c1
Sequence:CCGGGATGCTAAAGTCCCTGCTATTCTCGAGAATAGCAGGGACTTTAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028881.1-2167s21c1
Sequence:CCGGGAGGACTCATTCCGTAGTGATCTCGAGATCACTACGGAATGAGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028881.1-1053s21c1
Sequence:CCGGGACCCATACTATGACCCATTTCTCGAGAAATGGGTCATAGTATGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028881.1-751s1c1
Sequence:CCGGGATGCTAAAGTCCCTGCTATTCTCGAGAATAGCAGGGACTTTAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028881.1-1053s1c1
Sequence:CCGGGACCCATACTATGACCCATTTCTCGAGAAATGGGTCATAGTATGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028881.1-298s1c1
Sequence:CCGGGCTTATACAAGGAGCTCCCATCTCGAGATGGGAGCTCCTTGTATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028881.1-2167s1c1
Sequence:CCGGGAGGACTCATTCCGTAGTGATCTCGAGATCACTACGGAATGAGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194340    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028881.1-1758s1c1
Sequence:CCGGCCACCGCCCAATAAATGACTTCTCGAGAAGTCATTTATTGGGCGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193657    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028881.1-2462s1c1
Sequence:CCGGCAAGGTGTAGAGGGAAATCTTCTCGAGAAGATTTCCCTCTACACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193797    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028881.1-489s1c2
Sequence:CCGGCCACATTGACAGTTCTCCATACTCGAGTATGGAGAACTGTCAATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028881
VALIDATED
CRTC2 MISSION shRNA shRNA Plasmid DNA
CREB regulated transcription coactivator 2
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297698    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028881.1-2460s21c1
Sequence:CCGGAGCAAGGTGTAGAGGGAAATCCTCGAGGATTTCCCTCTACACCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028881.1-751s21c1
Sequence:CCGGGATGCTAAAGTCCCTGCTATTCTCGAGAATAGCAGGGACTTTAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028881.1-2167s21c1
Sequence:CCGGGAGGACTCATTCCGTAGTGATCTCGAGATCACTACGGAATGAGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028881.1-1053s21c1
Sequence:CCGGGACCCATACTATGACCCATTTCTCGAGAAATGGGTCATAGTATGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028881.1-751s1c1
Sequence:CCGGGATGCTAAAGTCCCTGCTATTCTCGAGAATAGCAGGGACTTTAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028881.1-1053s1c1
Sequence:CCGGGACCCATACTATGACCCATTTCTCGAGAAATGGGTCATAGTATGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028881.1-298s1c1
Sequence:CCGGGCTTATACAAGGAGCTCCCATCTCGAGATGGGAGCTCCTTGTATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028881.1-2167s1c1
Sequence:CCGGGAGGACTCATTCCGTAGTGATCTCGAGATCACTACGGAATGAGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194340    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028881.1-1758s1c1
Sequence:CCGGCCACCGCCCAATAAATGACTTCTCGAGAAGTCATTTATTGGGCGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193657    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028881.1-2462s1c1
Sequence:CCGGCAAGGTGTAGAGGGAAATCTTCTCGAGAAGATTTCCCTCTACACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193797    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028881.1-489s1c2
Sequence:CCGGCCACATTGACAGTTCTCCATACTCGAGTATGGAGAACTGTCAATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028881
VALIDATED
CRTC2 MISSION shRNA Lentiviral Transduction Particles
CREB regulated transcription coactivator 2
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297698    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028881.1-2460s21c1
Sequence:CCGGAGCAAGGTGTAGAGGGAAATCCTCGAGGATTTCCCTCTACACCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028881.1-751s21c1
Sequence:CCGGGATGCTAAAGTCCCTGCTATTCTCGAGAATAGCAGGGACTTTAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028881.1-2167s21c1
Sequence:CCGGGAGGACTCATTCCGTAGTGATCTCGAGATCACTACGGAATGAGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028881.1-1053s21c1
Sequence:CCGGGACCCATACTATGACCCATTTCTCGAGAAATGGGTCATAGTATGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028881.1-751s1c1
Sequence:CCGGGATGCTAAAGTCCCTGCTATTCTCGAGAATAGCAGGGACTTTAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028881.1-1053s1c1
Sequence:CCGGGACCCATACTATGACCCATTTCTCGAGAAATGGGTCATAGTATGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028881.1-298s1c1
Sequence:CCGGGCTTATACAAGGAGCTCCCATCTCGAGATGGGAGCTCCTTGTATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028881.1-2167s1c1
Sequence:CCGGGAGGACTCATTCCGTAGTGATCTCGAGATCACTACGGAATGAGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194340    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028881.1-1758s1c1
Sequence:CCGGCCACCGCCCAATAAATGACTTCTCGAGAAGTCATTTATTGGGCGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193657    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028881.1-2462s1c1
Sequence:CCGGCAAGGTGTAGAGGGAAATCTTCTCGAGAAGATTTCCCTCTACACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193797    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028881.1-489s1c2
Sequence:CCGGCCACATTGACAGTTCTCCATACTCGAGTATGGAGAACTGTCAATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181715
VALIDATED
CRTC2 MISSION shRNA Bacterial Glycerol Stock
CREB regulated transcription coactivator 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218012    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_181715.1-2365s21c1
Sequence:GTACCGGCCTAAAGCACTTGTAACTTTGCTCGAGCAAAGTTACAAGTGCTTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181715.1-676s21c1
Sequence:CCGGGGGTATTCTGGATGGTGAAATCTCGAGATTTCACCATCCAGAATACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181715.1-456s21c1
Sequence:CCGGCCTATAGTCCTGCCTACTTATCTCGAGATAAGTAGGCAGGACTATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_181715.1-392s21c1
Sequence:CCGGCAGCGAGATCCTCGAAGAATGCTCGAGCATTCTTCGAGGATCTCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181715.1-116s21c1
Sequence:CCGGGCTTCCAATCCGCGCAAATTTCTCGAGAAATTTGCGCGGATTGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181715
VALIDATED
CRTC2 MISSION shRNA shRNA Plasmid DNA
CREB regulated transcription coactivator 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218012    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_181715.1-2365s21c1
Sequence:GTACCGGCCTAAAGCACTTGTAACTTTGCTCGAGCAAAGTTACAAGTGCTTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181715.1-676s21c1
Sequence:CCGGGGGTATTCTGGATGGTGAAATCTCGAGATTTCACCATCCAGAATACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181715.1-456s21c1
Sequence:CCGGCCTATAGTCCTGCCTACTTATCTCGAGATAAGTAGGCAGGACTATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_181715.1-392s21c1
Sequence:CCGGCAGCGAGATCCTCGAAGAATGCTCGAGCATTCTTCGAGGATCTCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181715.1-116s21c1
Sequence:CCGGGCTTCCAATCCGCGCAAATTTCTCGAGAAATTTGCGCGGATTGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181715
VALIDATED
CRTC2 MISSION shRNA Lentiviral Transduction Particles
CREB regulated transcription coactivator 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218012    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_181715.1-2365s21c1
Sequence:GTACCGGCCTAAAGCACTTGTAACTTTGCTCGAGCAAAGTTACAAGTGCTTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181715.1-676s21c1
Sequence:CCGGGGGTATTCTGGATGGTGAAATCTCGAGATTTCACCATCCAGAATACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181715.1-456s21c1
Sequence:CCGGCCTATAGTCCTGCCTACTTATCTCGAGATAAGTAGGCAGGACTATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_181715.1-392s21c1
Sequence:CCGGCAGCGAGATCCTCGAAGAATGCTCGAGCATTCTTCGAGGATCTCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181715.1-116s21c1
Sequence:CCGGGCTTCCAATCCGCGCAAATTTCTCGAGAAATTTGCGCGGATTGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks