EMAIL THIS PAGE TO A FRIEND

CRTC3

CREB regulated transcription coactivator 3

89 Gene Product Result for
Synonyms: TORC-3 TORC3
UniProtKB ID: Q6UUV7, Q6DK61, Q6DK62, Q8NF38, Q9H6U2
Gene ID:
Human(64784) Summary: This gene is a member of the CREB regulated transcription coactivator gene family. This family regulates CREB-dependent gene transcription in a phosphorylation-independent manner and may be selective for cAMP-responsive genes. The protein encoded by this gene may induce mitochondrial biogenesis and attenuate catecholamine signaling in adipose tissue. A translocation event between this gene and Notch coactivator mastermind-like gene 2, which results in a fusion protein, has been reported in mucoepidermoid carcinomas. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012]
Mouse(70461) CREB regulated transcription coactivator 3
Rat(365297) CREB regulated transcription coactivator 3
Zebrafish(570024) CREB regulated transcription coactivator 3
dog(488747) CREB regulated transcription coactivator 3
cow(540109) CREB regulated transcription coactivator 3
Horse(100068775) CREB regulated transcription coactivator 3
domestic cat(101088084) CREB regulated transcription coactivator 3
sheep(101104349) CREB regulated transcription coactivator 3
Domestic Rabbit(100338531) CREB regulated transcription coactivator 3
naked mole-rat(101719615) CREB regulated transcription coactivator 3
domestic guinea pig(100732601) CREB regulated transcription coactivator 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022769 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022769 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022769 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173863 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173863 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173863 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042574 Rosetta Predictions human pricing
NM_022769 Rosetta Predictions human pricing
XM_001066604 Rosetta Predictions rat pricing
XM_344915 Rosetta Predictions rat pricing
NM_173863 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042574 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310608 predicted 581
2 SASI_Hs02_00310609 predicted 336
3 SASI_Hs02_00310610 predicted 580
4 SASI_Hs02_00310611 predicted 335
5 SASI_Hs02_00310612 predicted 1112
6 SASI_Hs02_00310613 predicted 2031
7 SASI_Hs02_00310614 predicted 325
8 SASI_Hs02_00310615 predicted 1031
9 SASI_Hs02_00310616 predicted 1203
10 SASI_Hs02_00310617 predicted 1096
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022769 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00356051 predicted 583
2 SASI_Hs01_00196026 predicted 337
3 SASI_Hs01_00196027 predicted 574
4 SASI_Hs01_00196028 predicted 337
5 SASI_Hs01_00196030 predicted 1108
6 SASI_Hs02_00356052 predicted 2029
7 SASI_Hs01_00196029 predicted 320
8 SASI_Hs01_00196032 predicted 1032
9 SASI_Hs02_00356053 predicted 1208
10 SASI_Hs02_00356054 predicted 1098
11 SASI_Hs01_00196031 predicted 1839
12 SASI_Hs01_00196033 predicted 1789
13 SASI_Hs01_00196034 predicted 1214
14 SASI_Hs01_00196035 predicted 221
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066604 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00318116 predicted 622
2 SASI_Rn02_00318117 predicted 484
3 SASI_Rn02_00318118 predicted 1352
4 SASI_Rn02_00318119 predicted 966
5 SASI_Rn02_00318120 predicted 1733
6 SASI_Rn02_00318121 predicted 1245
7 SASI_Rn02_00318122 predicted 1262
8 SASI_Rn02_00318123 predicted 779
9 SASI_Rn02_00318124 predicted 1745
10 SASI_Rn02_00318125 predicted 1919
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_344915 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00397746 predicted 561
2 SASI_Rn02_00397747 predicted 433
3 SASI_Rn02_00397748 predicted 1287
4 SASI_Rn02_00397749 predicted 910
5 SASI_Rn02_00397750 predicted 554
6 SASI_Rn02_00397751 predicted 1671
7 SASI_Rn02_00397752 predicted 1188
8 SASI_Rn02_00397753 predicted 1204
9 SASI_Rn02_00397754 predicted 713
10 SASI_Rn02_00397755 predicted 1687
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173863 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00194469 predicted 1974
2 SASI_Mm02_00345448 predicted 2019
3 SASI_Mm02_00345449 predicted 1911
4 SASI_Mm02_00345450 predicted 1103
5 SASI_Mm02_00345451 predicted 480
6 SASI_Mm02_00345452 predicted 962
7 SASI_Mm02_00345453 predicted 1138
8 SASI_Mm02_00345454 predicted 598
9 SASI_Mm02_00345455 predicted 701
10 SASI_Mm02_00345456 predicted 803
11 SASI_Mm01_00194470 predicted 1621
12 SASI_Mm01_00194471 predicted 998
13 SASI_Mm01_00194472 predicted 2145
14 SASI_Mm01_00194473 predicted 2272
15 SASI_Mm01_00194474 predicted 1920
16 SASI_Mm01_00194475 predicted 1631
17 SASI_Mm01_00194476 predicted 1825
18 SASI_Mm01_00194477 predicted 2117
19 SASI_Mm01_00194478 predicted 1956
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022769
VALIDATED
CRTC3 MISSION shRNA Bacterial Glycerol Stock
CREB regulated transcription coactivator 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123184    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022769.2-1875s1c1
Sequence:CCGGGCAGTGGAACAGAAGAATGTTCTCGAGAACATTCTTCTGTTCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022769.2-181s1c1
Sequence:CCGGCCATGGAGGATCCTTACCAAACTCGAGTTTGGTAAGGATCCTCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022769.2-1120s1c1
Sequence:CCGGCCCATCTCTTTCCACCACAAACTCGAGTTTGTGGTGGAAAGAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022769.2-1829s1c1
Sequence:CCGGCCCTCTGTTGAAGAGACGTTTCTCGAGAAACGTCTCTTCAACAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022769.2-1014s1c1
Sequence:CCGGCGCTCAATAAGACTGTGCTTTCTCGAGAAAGCACAGTCTTATTGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022769.3-326s21c1
Sequence:CCGGTCAGAGTTTCAGCCGTCATTTCTCGAGAAATGACGGCTGAAACTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022769.3-1042s21c1
Sequence:CCGGTATGACCCACCTGGGTATAAGCTCGAGCTTATACCCAGGTGGGTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298213    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022769.3-1974s21c1
Sequence:CCGGGCAGTGGAACAGAAGAATGTTCTCGAGAACATTCTTCTGTTCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022769.3-1219s21c1
Sequence:CCGGCCCATCTCTTTCCACCACAAACTCGAGTTTGTGGTGGAAAGAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022769
VALIDATED
CRTC3 MISSION shRNA shRNA Plasmid DNA
CREB regulated transcription coactivator 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123184    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022769.2-1875s1c1
Sequence:CCGGGCAGTGGAACAGAAGAATGTTCTCGAGAACATTCTTCTGTTCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022769.2-181s1c1
Sequence:CCGGCCATGGAGGATCCTTACCAAACTCGAGTTTGGTAAGGATCCTCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022769.2-1120s1c1
Sequence:CCGGCCCATCTCTTTCCACCACAAACTCGAGTTTGTGGTGGAAAGAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022769.2-1829s1c1
Sequence:CCGGCCCTCTGTTGAAGAGACGTTTCTCGAGAAACGTCTCTTCAACAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022769.2-1014s1c1
Sequence:CCGGCGCTCAATAAGACTGTGCTTTCTCGAGAAAGCACAGTCTTATTGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022769.3-326s21c1
Sequence:CCGGTCAGAGTTTCAGCCGTCATTTCTCGAGAAATGACGGCTGAAACTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022769.3-1042s21c1
Sequence:CCGGTATGACCCACCTGGGTATAAGCTCGAGCTTATACCCAGGTGGGTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298213    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022769.3-1974s21c1
Sequence:CCGGGCAGTGGAACAGAAGAATGTTCTCGAGAACATTCTTCTGTTCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022769.3-1219s21c1
Sequence:CCGGCCCATCTCTTTCCACCACAAACTCGAGTTTGTGGTGGAAAGAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022769
VALIDATED
CRTC3 MISSION shRNA Lentiviral Transduction Particles
CREB regulated transcription coactivator 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123184    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022769.2-1875s1c1
Sequence:CCGGGCAGTGGAACAGAAGAATGTTCTCGAGAACATTCTTCTGTTCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022769.2-181s1c1
Sequence:CCGGCCATGGAGGATCCTTACCAAACTCGAGTTTGGTAAGGATCCTCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022769.2-1120s1c1
Sequence:CCGGCCCATCTCTTTCCACCACAAACTCGAGTTTGTGGTGGAAAGAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022769.2-1829s1c1
Sequence:CCGGCCCTCTGTTGAAGAGACGTTTCTCGAGAAACGTCTCTTCAACAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022769.2-1014s1c1
Sequence:CCGGCGCTCAATAAGACTGTGCTTTCTCGAGAAAGCACAGTCTTATTGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022769.3-326s21c1
Sequence:CCGGTCAGAGTTTCAGCCGTCATTTCTCGAGAAATGACGGCTGAAACTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022769.3-1042s21c1
Sequence:CCGGTATGACCCACCTGGGTATAAGCTCGAGCTTATACCCAGGTGGGTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298213    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022769.3-1974s21c1
Sequence:CCGGGCAGTGGAACAGAAGAATGTTCTCGAGAACATTCTTCTGTTCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022769.3-1219s21c1
Sequence:CCGGCCCATCTCTTTCCACCACAAACTCGAGTTTGTGGTGGAAAGAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173863
VALIDATED
CRTC3 MISSION shRNA Bacterial Glycerol Stock
CREB regulated transcription coactivator 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241211    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173863.2-4524s21c1
Sequence:CCGGTTTCATGTGTGTAGCTTTAAGCTCGAGCTTAAAGCTACACACATGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241213    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173863.2-3616s21c1
Sequence:CCGGCCTTCTCACACAGTAAGTAATCTCGAGATTACTTACTGTGTGAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241214    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173863.2-4857s21c1
Sequence:CCGGTATTCATGCTCGTGCACATATCTCGAGATATGTGCACGAGCATGAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241212    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173863.2-4892s21c1
Sequence:CCGGTGTTGGGCTCTTCTGATTTATCTCGAGATAAATCAGAAGAGCCCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241210    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173863.2-4474s21c1
Sequence:CCGGGACAATGTAGCACTGAATTAACTCGAGTTAATTCAGTGCTACATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173863
VALIDATED
CRTC3 MISSION shRNA shRNA Plasmid DNA
CREB regulated transcription coactivator 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241211    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173863.2-4524s21c1
Sequence:CCGGTTTCATGTGTGTAGCTTTAAGCTCGAGCTTAAAGCTACACACATGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241213    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173863.2-3616s21c1
Sequence:CCGGCCTTCTCACACAGTAAGTAATCTCGAGATTACTTACTGTGTGAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241214    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173863.2-4857s21c1
Sequence:CCGGTATTCATGCTCGTGCACATATCTCGAGATATGTGCACGAGCATGAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241212    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173863.2-4892s21c1
Sequence:CCGGTGTTGGGCTCTTCTGATTTATCTCGAGATAAATCAGAAGAGCCCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241210    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173863.2-4474s21c1
Sequence:CCGGGACAATGTAGCACTGAATTAACTCGAGTTAATTCAGTGCTACATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173863
VALIDATED
CRTC3 MISSION shRNA Lentiviral Transduction Particles
CREB regulated transcription coactivator 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241211    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173863.2-4524s21c1
Sequence:CCGGTTTCATGTGTGTAGCTTTAAGCTCGAGCTTAAAGCTACACACATGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241213    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173863.2-3616s21c1
Sequence:CCGGCCTTCTCACACAGTAAGTAATCTCGAGATTACTTACTGTGTGAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241214    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173863.2-4857s21c1
Sequence:CCGGTATTCATGCTCGTGCACATATCTCGAGATATGTGCACGAGCATGAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241212    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173863.2-4892s21c1
Sequence:CCGGTGTTGGGCTCTTCTGATTTATCTCGAGATAAATCAGAAGAGCCCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241210    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173863.2-4474s21c1
Sequence:CCGGGACAATGTAGCACTGAATTAACTCGAGTTAATTCAGTGCTACATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks