EMAIL THIS PAGE TO A FRIEND

CRX

cone-rod homeobox

145 Gene Product Result for
Synonyms: CORD2 CRD LCA7 OTX3
UniProtKB ID: O43186
Gene ID:
Human(1406) Summary: The protein encoded by this gene is a photoreceptor-specific transcription factor which plays a role in the differentiation of photoreceptor cells. This homeodomain protein is necessary for the maintenance of normal cone and rod function. Mutations in this gene are associated with photoreceptor degeneration, Leber congenital amaurosis type III and the autosomal dominant cone-rod dystrophy 2. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some variants has not been determined. [provided by RefSeq, Jul 2008]
Mouse(12951) cone-rod homeobox containing gene
Rat(60446) cone-rod homeobox
Zebrafish(81881) cone-rod homeobox
cow(280756) cone-rod homeobox
domestic cat(100379624) cone-rod homeobox
dog(403577) cone-rod homeobox
sheep(101119581) cone-rod homeobox
domestic guinea pig(100721038) cone-rod homeobox
naked mole-rat(101705886) cone-rod homeobox
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007770 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007770 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007770 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000554 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000554 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000554 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000554 Rosetta Predictions human pricing
NM_021855 Rosetta Predictions rat pricing
NM_001113330 Rosetta Predictions mouse pricing
NM_007770 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000554 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00186777 predicted 1296
2 SASI_Hs01_00186783 predicted 1298
3 SASI_Hs01_00186778 predicted 984
4 SASI_Hs01_00186779 predicted 1076
5 SASI_Hs01_00186780 predicted 267
6 SASI_Hs01_00186781 predicted 1079
7 SASI_Hs01_00186782 predicted 1337
8 SASI_Hs02_00302799 predicted 328
9 SASI_Hs02_00302800 predicted 444
10 SASI_Hs01_00186784 predicted 1340
11 SASI_Hs01_00186785 predicted 611
12 SASI_Hs01_00186786 predicted 1025
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021855 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00122032 predicted 629
2 SASI_Rn01_00122034 predicted 527
3 SASI_Rn01_00122035 predicted 618
4 SASI_Rn01_00122036 predicted 620
5 SASI_Rn01_00122037 predicted 618
6 SASI_Rn02_00262882 predicted 589
7 SASI_Rn01_00122038 predicted 640
8 SASI_Rn01_00122039 predicted 635
9 SASI_Rn01_00122040 predicted 633
10 SASI_Rn01_00122041 predicted 647
11 SASI_Rn01_00122033 predicted 600
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113330 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00307373 predicted 1398
2 SASI_Mm02_00307374 predicted 1022
3 SASI_Mm02_00307375 predicted 1303
4 SASI_Mm02_00307376 predicted 1285
5 SASI_Mm02_00307377 predicted 770
6 SASI_Mm02_00307378 predicted 1458
7 SASI_Mm02_00307379 predicted 1072
8 SASI_Mm02_00307380 predicted 1290
9 SASI_Mm02_00307381 predicted 1438
10 SASI_Mm02_00307382 predicted 1129
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007770 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00125469 predicted 1425
2 SASI_Mm01_00125470 predicted 1052
3 SASI_Mm01_00125472 predicted 1327
4 SASI_Mm01_00125473 predicted 1311
5 SASI_Mm01_00125474 predicted 803
6 SASI_Mm01_00125475 predicted 1487
7 SASI_Mm01_00125476 predicted 1099
8 SASI_Mm02_00312405 predicted 1325
9 SASI_Mm01_00125477 predicted 1467
10 SASI_Mm01_00125478 predicted 1155
11 SASI_Mm01_00125471 predicted 1348
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007770
CRX MISSION shRNA Bacterial Glycerol Stock
cone-rod homeobox
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007770.4-1021s21c1
Sequence:CCGGTGGACCCTCTGGACTACAAAGCTCGAGCTTTGTAGTCCAGAGGGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007770.4-377s21c1
Sequence:CCGGACGTGAGGAGGTTGCTCTTAACTCGAGTTAAGAGCAACCTCCTCACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415255    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007770.4-1475s21c1
Sequence:CCGGGACTGACTCAATGGTCATAATCTCGAGATTATGACCATTGAGTCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422168    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007770.4-1094s21c1
Sequence:CCGGTTCCAGCGGAATCACTCTTTCCTCGAGGAAAGAGTGATTCCGCTGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426747    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007770.4-1556s21c1
Sequence:CCGGCAAAGTGAGACCTCCAAATTCCTCGAGGAATTTGGAGGTCTCACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007770.2-938s1c1
Sequence:CCGGACCTGGAAATTTACCTACAATCTCGAGATTGTAGGTAAATTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007770.2-502s1c1
Sequence:CCGGAGATGTTTGTACAGATCCTTTCTCGAGAAAGGATCTGTACAAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007770.2-142s1c1
Sequence:CCGGTCACTATTCAGTCAATGCCTTCTCGAGAAGGCATTGACTGAATAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007770.2-993s1c1
Sequence:CCGGCCTGGAAGTTTCAGATCTTGTCTCGAGACAAGATCTGAAACTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007770.2-375s1c1
Sequence:CCGGTCAAGAATCGTAGGGCGAAATCTCGAGATTTCGCCCTACGATTCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007770
CRX MISSION shRNA shRNA Plasmid DNA
cone-rod homeobox
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007770.4-1021s21c1
Sequence:CCGGTGGACCCTCTGGACTACAAAGCTCGAGCTTTGTAGTCCAGAGGGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007770.4-377s21c1
Sequence:CCGGACGTGAGGAGGTTGCTCTTAACTCGAGTTAAGAGCAACCTCCTCACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415255    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007770.4-1475s21c1
Sequence:CCGGGACTGACTCAATGGTCATAATCTCGAGATTATGACCATTGAGTCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422168    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007770.4-1094s21c1
Sequence:CCGGTTCCAGCGGAATCACTCTTTCCTCGAGGAAAGAGTGATTCCGCTGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426747    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007770.4-1556s21c1
Sequence:CCGGCAAAGTGAGACCTCCAAATTCCTCGAGGAATTTGGAGGTCTCACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007770.2-938s1c1
Sequence:CCGGACCTGGAAATTTACCTACAATCTCGAGATTGTAGGTAAATTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007770.2-502s1c1
Sequence:CCGGAGATGTTTGTACAGATCCTTTCTCGAGAAAGGATCTGTACAAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007770.2-142s1c1
Sequence:CCGGTCACTATTCAGTCAATGCCTTCTCGAGAAGGCATTGACTGAATAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007770.2-993s1c1
Sequence:CCGGCCTGGAAGTTTCAGATCTTGTCTCGAGACAAGATCTGAAACTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007770.2-375s1c1
Sequence:CCGGTCAAGAATCGTAGGGCGAAATCTCGAGATTTCGCCCTACGATTCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007770
CRX MISSION shRNA Lentiviral Transduction Particles
cone-rod homeobox
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007770.4-1021s21c1
Sequence:CCGGTGGACCCTCTGGACTACAAAGCTCGAGCTTTGTAGTCCAGAGGGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007770.4-377s21c1
Sequence:CCGGACGTGAGGAGGTTGCTCTTAACTCGAGTTAAGAGCAACCTCCTCACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415255    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007770.4-1475s21c1
Sequence:CCGGGACTGACTCAATGGTCATAATCTCGAGATTATGACCATTGAGTCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422168    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007770.4-1094s21c1
Sequence:CCGGTTCCAGCGGAATCACTCTTTCCTCGAGGAAAGAGTGATTCCGCTGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426747    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007770.4-1556s21c1
Sequence:CCGGCAAAGTGAGACCTCCAAATTCCTCGAGGAATTTGGAGGTCTCACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007770.2-938s1c1
Sequence:CCGGACCTGGAAATTTACCTACAATCTCGAGATTGTAGGTAAATTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007770.2-502s1c1
Sequence:CCGGAGATGTTTGTACAGATCCTTTCTCGAGAAAGGATCTGTACAAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007770.2-142s1c1
Sequence:CCGGTCACTATTCAGTCAATGCCTTCTCGAGAAGGCATTGACTGAATAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007770.2-993s1c1
Sequence:CCGGCCTGGAAGTTTCAGATCTTGTCTCGAGACAAGATCTGAAACTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007770.2-375s1c1
Sequence:CCGGTCAAGAATCGTAGGGCGAAATCTCGAGATTTCGCCCTACGATTCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000554
CRX MISSION shRNA Bacterial Glycerol Stock
cone-rod homeobox
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000554.2-1528s1c1
Sequence:CCGGCCGTCTCAATAATAACAACAACTCGAGTTGTTGTTATTATTGAGACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000554.2-960s1c1
Sequence:CCGGGCACCTGGAAATTCACCTACACTCGAGTGTAGGTGAATTTCCAGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000554.2-928s1c1
Sequence:CCGGCGTGGATAGCTTGGAATTCAACTCGAGTTGAATTCCAAGCTATCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000554.2-166s1c1
Sequence:CCGGCCACTATTCTGTCAACGCCTTCTCGAGAAGGCGTTGACAGAATAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000554.2-360s1c1
Sequence:CCGGTGAAGATCAATCTGCCTGAGTCTCGAGACTCAGGCAGATTGATCTTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000554
CRX MISSION shRNA shRNA Plasmid DNA
cone-rod homeobox
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000554.2-1528s1c1
Sequence:CCGGCCGTCTCAATAATAACAACAACTCGAGTTGTTGTTATTATTGAGACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000554.2-960s1c1
Sequence:CCGGGCACCTGGAAATTCACCTACACTCGAGTGTAGGTGAATTTCCAGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000554.2-928s1c1
Sequence:CCGGCGTGGATAGCTTGGAATTCAACTCGAGTTGAATTCCAAGCTATCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000554.2-166s1c1
Sequence:CCGGCCACTATTCTGTCAACGCCTTCTCGAGAAGGCGTTGACAGAATAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000554.2-360s1c1
Sequence:CCGGTGAAGATCAATCTGCCTGAGTCTCGAGACTCAGGCAGATTGATCTTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000554
CRX MISSION shRNA Lentiviral Transduction Particles
cone-rod homeobox
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000554.2-1528s1c1
Sequence:CCGGCCGTCTCAATAATAACAACAACTCGAGTTGTTGTTATTATTGAGACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000554.2-960s1c1
Sequence:CCGGGCACCTGGAAATTCACCTACACTCGAGTGTAGGTGAATTTCCAGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000554.2-928s1c1
Sequence:CCGGCGTGGATAGCTTGGAATTCAACTCGAGTTGAATTCCAAGCTATCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000554.2-166s1c1
Sequence:CCGGCCACTATTCTGTCAACGCCTTCTCGAGAAGGCGTTGACAGAATAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000554.2-360s1c1
Sequence:CCGGTGAAGATCAATCTGCCTGAGTCTCGAGACTCAGGCAGATTGATCTTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks