EMAIL THIS PAGE TO A FRIEND

CRY1

cryptochrome 1 (photolyase-like)

83 Gene Product Result for
Synonyms: PHLL1
UniProtKB ID: Q16526
Gene ID:
Human(1407) Summary: This gene encodes a flavin adenine dinucleotide-binding protein that is a key component of the circadian core oscillator complex, which regulates the circadian clock. The encoded protein is widely conserved across plants and animals. Loss of the related gene in mouse results in a shortened circadian cycle in complete darkness. [provided by RefSeq, Aug 2012]
Mouse(12952) cryptochrome 1 (photolyase-like)
Rat(299691) cryptochrome 1 (photolyase-like)
Thale Cress(826470) cryptochrome-1
chicken(374093) cryptochrome 1 (photolyase-like)
cow(535947) cryptochrome 1 (photolyase-like)
Horse(100034165) cryptochrome 1 (photolyase-like)
domestic cat(101089451) cryptochrome 1 (photolyase-like)
dog(474528) cryptochrome 1 (photolyase-like)
sheep(443263) cryptochrome 1 (photolyase-like)
domestic guinea pig(100714070) cryptochrome 1 (photolyase-like)
naked mole-rat(101719696) cryptochrome 1 (photolyase-like)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007771 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007771 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007771 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004075 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004075 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004075 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004075 Rosetta Predictions human pricing
NM_198750 Rosetta Predictions rat pricing
NM_007771 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004075 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192668 predicted 1713
2 SASI_Hs01_00192669 predicted 1615
3 SASI_Hs01_00192670 predicted 995
4 SASI_Hs01_00192671 predicted 2137
5 SASI_Hs01_00192672 predicted 1717
6 SASI_Hs01_00192673 predicted 1147
7 SASI_Hs01_00192674 predicted 2543
8 SASI_Hs01_00192675 predicted 2628
9 SASI_Hs01_00192677 predicted 2083
10 SASI_Hs02_00336869 predicted 1258
11 SASI_Hs01_00192676 predicted 1097
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198750 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00106227 predicted 677
2 SASI_Rn01_00106228 predicted 912
3 SASI_Rn01_00106229 predicted 1595
4 SASI_Rn02_00269973 predicted 808
5 SASI_Rn01_00106230 predicted 2190
6 SASI_Rn01_00106231 predicted 1283
7 SASI_Rn01_00106232 predicted 2122
8 SASI_Rn01_00106233 predicted 1805
9 SASI_Rn01_00106234 predicted 1186
10 SASI_Rn01_00106235 predicted 817
11 SASI_Rn01_00106236 predicted 799
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007771 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00312406 predicted 1474
2 SASI_Mm02_00312407 predicted 716
3 SASI_Mm02_00312408 predicted 1331
4 SASI_Mm02_00312409 predicted 1091
5 SASI_Mm02_00312410 predicted 1239
6 SASI_Mm02_00312411 predicted 1954
7 SASI_Mm02_00312412 predicted 2139
8 SASI_Mm02_00312413 predicted 979
9 SASI_Mm02_00312414 predicted 957
10 SASI_Mm02_00312415 predicted 1863
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007771
VALIDATED
CRY1 MISSION shRNA Bacterial Glycerol Stock
cryptochrome 1 (photolyase-like)
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007771.3-1955s21c1
Sequence:CCGGGCCAAGTGTTTGATAGGAGTTCTCGAGAACTCCTATCAAACACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007771.3-1016s21c1
Sequence:CCGGCAGCCACCTCTAACATATAAACTCGAGTTTATATGTTAGAGGTGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007771.3-2009s21c1
Sequence:CCGGGCAAGCAGACTGAATATTGAACTCGAGTTCAATATTCAGTCTGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337711    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007771.3-2810s21c1
Sequence:CCGGACATCAGTGTTTGATCTAATTCTCGAGAATTAGATCAAACACTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007771.3-2232s21c1
Sequence:CCGGGCTCTCAAGGAAGTGGTATTTCTCGAGAAATACCACTTCCTTGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216310    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007771.3-1862s1c1
Sequence:CCGGGACTATATTAGGCGTTATTTACTCGAGTAAATAACGCCTAATATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007771.2-787s1c1
Sequence:CCGGCAGCCACCTCTAACATATAAACTCGAGTTTATATGTTAGAGGTGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007771.2-1780s1c1
Sequence:CCGGGCAAGCAGACTGAATATTGAACTCGAGTTCAATATTCAGTCTGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007771.2-1726s1c1
Sequence:CCGGGCCAAGTGTTTGATAGGAGTTCTCGAGAACTCCTATCAAACACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007771.2-2003s1c1
Sequence:CCGGGCTCTCAAGGAAGTGGTATTTCTCGAGAAATACCACTTCCTTGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194462    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007771.2-532s1c1
Sequence:CCGGGAGGATCTTGATGCCAATCTACTCGAGTAGATTGGCATCAAGATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193765    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007771.2-618s1c1
Sequence:CCGGCAAGGAATGGAACATCACTAACTCGAGTTAGTGATGTTCCATTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007771
VALIDATED
CRY1 MISSION shRNA shRNA Plasmid DNA
cryptochrome 1 (photolyase-like)
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007771.3-1955s21c1
Sequence:CCGGGCCAAGTGTTTGATAGGAGTTCTCGAGAACTCCTATCAAACACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007771.3-1016s21c1
Sequence:CCGGCAGCCACCTCTAACATATAAACTCGAGTTTATATGTTAGAGGTGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007771.3-2009s21c1
Sequence:CCGGGCAAGCAGACTGAATATTGAACTCGAGTTCAATATTCAGTCTGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337711    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007771.3-2810s21c1
Sequence:CCGGACATCAGTGTTTGATCTAATTCTCGAGAATTAGATCAAACACTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007771.3-2232s21c1
Sequence:CCGGGCTCTCAAGGAAGTGGTATTTCTCGAGAAATACCACTTCCTTGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216310    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007771.3-1862s1c1
Sequence:CCGGGACTATATTAGGCGTTATTTACTCGAGTAAATAACGCCTAATATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007771.2-787s1c1
Sequence:CCGGCAGCCACCTCTAACATATAAACTCGAGTTTATATGTTAGAGGTGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007771.2-1780s1c1
Sequence:CCGGGCAAGCAGACTGAATATTGAACTCGAGTTCAATATTCAGTCTGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007771.2-1726s1c1
Sequence:CCGGGCCAAGTGTTTGATAGGAGTTCTCGAGAACTCCTATCAAACACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007771.2-2003s1c1
Sequence:CCGGGCTCTCAAGGAAGTGGTATTTCTCGAGAAATACCACTTCCTTGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194462    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007771.2-532s1c1
Sequence:CCGGGAGGATCTTGATGCCAATCTACTCGAGTAGATTGGCATCAAGATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193765    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007771.2-618s1c1
Sequence:CCGGCAAGGAATGGAACATCACTAACTCGAGTTAGTGATGTTCCATTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007771
VALIDATED
CRY1 MISSION shRNA Lentiviral Transduction Particles
cryptochrome 1 (photolyase-like)
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007771.3-1955s21c1
Sequence:CCGGGCCAAGTGTTTGATAGGAGTTCTCGAGAACTCCTATCAAACACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007771.3-1016s21c1
Sequence:CCGGCAGCCACCTCTAACATATAAACTCGAGTTTATATGTTAGAGGTGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007771.3-2009s21c1
Sequence:CCGGGCAAGCAGACTGAATATTGAACTCGAGTTCAATATTCAGTCTGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337711    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007771.3-2810s21c1
Sequence:CCGGACATCAGTGTTTGATCTAATTCTCGAGAATTAGATCAAACACTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007771.3-2232s21c1
Sequence:CCGGGCTCTCAAGGAAGTGGTATTTCTCGAGAAATACCACTTCCTTGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216310    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007771.3-1862s1c1
Sequence:CCGGGACTATATTAGGCGTTATTTACTCGAGTAAATAACGCCTAATATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007771.2-787s1c1
Sequence:CCGGCAGCCACCTCTAACATATAAACTCGAGTTTATATGTTAGAGGTGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007771.2-1780s1c1
Sequence:CCGGGCAAGCAGACTGAATATTGAACTCGAGTTCAATATTCAGTCTGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007771.2-1726s1c1
Sequence:CCGGGCCAAGTGTTTGATAGGAGTTCTCGAGAACTCCTATCAAACACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007771.2-2003s1c1
Sequence:CCGGGCTCTCAAGGAAGTGGTATTTCTCGAGAAATACCACTTCCTTGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194462    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007771.2-532s1c1
Sequence:CCGGGAGGATCTTGATGCCAATCTACTCGAGTAGATTGGCATCAAGATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193765    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007771.2-618s1c1
Sequence:CCGGCAAGGAATGGAACATCACTAACTCGAGTTAGTGATGTTCCATTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004075
VALIDATED
CRY1 MISSION shRNA Bacterial Glycerol Stock
cryptochrome 1 (photolyase-like)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218592    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004075.3-3079s21c1
Sequence:GTACCGGGCGTAATCCAAATTGGTATTGCTCGAGCAATACCAATTTGGATTACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004075.3-2599s21c1
Sequence:CCGGCCAGAGACAGAGCACTAATTACTCGAGTAATTAGTGCTCTGTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004075.3-2137s21c1
Sequence:CCGGAGACTATATCAGGCGTTATTTCTCGAGAAATAACGCCTGATATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004075.3-1289s21c1
Sequence:CCGGGGACAACCGCCTCTAACTTATCTCGAGATAAGTTAGAGGCGGTTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004075.3-1180s21c1
Sequence:CCGGGGAACGAGACGCAGCTATTAACTCGAGTTAATAGCTGCGTCTCGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011304    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_004075.2-2829s1c1
Sequence:CCGGCCTCTGTTAACACAGACAGTACTCGAGTACTGTCTGTGTTAACAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004075.2-2017s1c1
Sequence:CCGGCCGTTTGAATATCGAAAGGATCTCGAGATCCTTTCGATATTCAAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004075.2-992s1c1
Sequence:CCGGGACAAGATCATAGAACTCAATCTCGAGATTGAGTTCTATGATCTTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004075.2-1450s1c1
Sequence:CCGGGCAACTGTTATGGCGTGAATTCTCGAGAATTCACGCCATAACAGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004075.2-1484s1c1
Sequence:CCGGGCAACAAATAATCCACGCTTTCTCGAGAAAGCGTGGATTATTTGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004075
VALIDATED
CRY1 MISSION shRNA shRNA Plasmid DNA
cryptochrome 1 (photolyase-like)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218592    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004075.3-3079s21c1
Sequence:GTACCGGGCGTAATCCAAATTGGTATTGCTCGAGCAATACCAATTTGGATTACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004075.3-2599s21c1
Sequence:CCGGCCAGAGACAGAGCACTAATTACTCGAGTAATTAGTGCTCTGTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004075.3-2137s21c1
Sequence:CCGGAGACTATATCAGGCGTTATTTCTCGAGAAATAACGCCTGATATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004075.3-1289s21c1
Sequence:CCGGGGACAACCGCCTCTAACTTATCTCGAGATAAGTTAGAGGCGGTTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004075.3-1180s21c1
Sequence:CCGGGGAACGAGACGCAGCTATTAACTCGAGTTAATAGCTGCGTCTCGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011304    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_004075.2-2829s1c1
Sequence:CCGGCCTCTGTTAACACAGACAGTACTCGAGTACTGTCTGTGTTAACAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004075.2-2017s1c1
Sequence:CCGGCCGTTTGAATATCGAAAGGATCTCGAGATCCTTTCGATATTCAAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004075.2-992s1c1
Sequence:CCGGGACAAGATCATAGAACTCAATCTCGAGATTGAGTTCTATGATCTTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004075.2-1450s1c1
Sequence:CCGGGCAACTGTTATGGCGTGAATTCTCGAGAATTCACGCCATAACAGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004075.2-1484s1c1
Sequence:CCGGGCAACAAATAATCCACGCTTTCTCGAGAAAGCGTGGATTATTTGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004075
VALIDATED
CRY1 MISSION shRNA Lentiviral Transduction Particles
cryptochrome 1 (photolyase-like)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218592    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004075.3-3079s21c1
Sequence:GTACCGGGCGTAATCCAAATTGGTATTGCTCGAGCAATACCAATTTGGATTACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004075.3-2599s21c1
Sequence:CCGGCCAGAGACAGAGCACTAATTACTCGAGTAATTAGTGCTCTGTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004075.3-2137s21c1
Sequence:CCGGAGACTATATCAGGCGTTATTTCTCGAGAAATAACGCCTGATATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004075.3-1289s21c1
Sequence:CCGGGGACAACCGCCTCTAACTTATCTCGAGATAAGTTAGAGGCGGTTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004075.3-1180s21c1
Sequence:CCGGGGAACGAGACGCAGCTATTAACTCGAGTTAATAGCTGCGTCTCGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011304    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_004075.2-2829s1c1
Sequence:CCGGCCTCTGTTAACACAGACAGTACTCGAGTACTGTCTGTGTTAACAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004075.2-2017s1c1
Sequence:CCGGCCGTTTGAATATCGAAAGGATCTCGAGATCCTTTCGATATTCAAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004075.2-992s1c1
Sequence:CCGGGACAAGATCATAGAACTCAATCTCGAGATTGAGTTCTATGATCTTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004075.2-1450s1c1
Sequence:CCGGGCAACTGTTATGGCGTGAATTCTCGAGAATTCACGCCATAACAGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004075.2-1484s1c1
Sequence:CCGGGCAACAAATAATCCACGCTTTCTCGAGAAAGCGTGGATTATTTGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks