EMAIL THIS PAGE TO A FRIEND

CRYAA

crystallin, alpha A

55 Gene Product Result for
Synonyms: CRYA1 CTRCT9 HSPB4
UniProtKB ID: P02489, Q53X53
Gene ID:
Human(1409) Summary: Crystallins are separated into two classes: taxon-specific, or enzyme, and ubiquitous. The latter class constitutes the major proteins of vertebrate eye lens and maintains the transparency and refractive index of the lens. Since lens central fiber cells lose their nuclei during development, these crystallins are made and then retained throughout life, making them extremely stable proteins. Mammalian lens crystallins are divided into alpha, beta, and gamma families; beta and gamma crystallins are also considered as a superfamily. Alpha and beta families are further divided into acidic and basic groups. Seven protein regions exist in crystallins: four homologous motifs, a connecting peptide, and N- and C-terminal extensions. Alpha crystallins are composed of two gene products: alpha-A and alpha-B, for acidic and basic, respectively. Alpha crystallins can be induced by heat shock and are members of the small heat shock protein (sHSP also known as the HSP20) family. They act as molecular chaperones although they do not renature proteins and release them in the fashion of a true chaperone; instead they hold them in large soluble aggregates. Post-translational modifications decrease the ability to chaperone. These heterogeneous aggregates consist of 30-40 subunits; the alpha-A and alpha-B subunits have a 3:1 ratio, respectively. Two additional functions of alpha crystallins are an autokinase activity and participation in the intracellular architecture. Alpha-A and alpha-B gene products are differentially expressed; alpha-A is preferentially restricted to the lens and alpha-B is expressed widely in many tissues and organs. Defects in this gene cause autosomal dominant congenital cataract (ADCC). [provided by RefSeq, Jul 2008]
Mouse(12954) crystallin, alpha A
Rat(24273) crystallin, alpha A
Zebrafish(100000769) crystallin, alpha A
Horse(100051134) crystallin, alpha A
cow(281718) crystallin, alpha A
domestic cat(101083874) crystallin, alpha A
chicken(418546) crystallin, alpha A
dog(487786) crystallin, alpha A
sheep(497275) crystallin, alpha A
Domestic Rabbit(100009294) crystallin, alpha A
domestic guinea pig(100135506) crystallin, alpha A
naked mole-rat(101702377) crystallin, alpha A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0578 AQUA Peptide SDRDKFV[I]FLDVKHF human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000394 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000394 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000394 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013501 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013501 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013501 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU003721 MISSION® esiRNA esiRNA targeting human CRYAA (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000394 Rosetta Predictions human pricing
NM_012534 Rosetta Predictions rat pricing
NM_013501 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000394 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00147592 predicted 323
2 SASI_Hs01_00147593 predicted 736
3 SASI_Hs01_00147594 predicted 384
4 SASI_Hs01_00147595 predicted 206
5 SASI_Hs01_00147596 predicted 789
6 SASI_Hs01_00147597 predicted 266
7 SASI_Hs01_00147598 predicted 242
8 SASI_Hs01_00147599 predicted 695
9 SASI_Hs01_00147600 predicted 593
10 SASI_Hs02_00302467 predicted 843
11 SASI_Hs01_00147601 predicted 788
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012534 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00102165 predicted 819
2 SASI_Rn01_00102166 predicted 653
3 SASI_Rn01_00102167 predicted 326
4 SASI_Rn01_00102168 predicted 655
5 SASI_Rn01_00102169 predicted 819
6 SASI_Rn01_00102170 predicted 361
7 SASI_Rn01_00102171 predicted 804
8 SASI_Rn01_00102172 predicted 799
9 SASI_Rn01_00102173 predicted 328
10 SASI_Rn02_00259611 predicted 745
11 SASI_Rn01_00102174 predicted 767
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013501 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00322153 predicted 871
2 SASI_Mm01_00058445 predicted 247
3 SASI_Mm01_00058446 predicted 441
4 SASI_Mm02_00322154 predicted 588
5 SASI_Mm01_00058447 predicted 407
6 SASI_Mm01_00058448 predicted 471
7 SASI_Mm01_00058449 predicted 442
8 SASI_Mm02_00322155 predicted 776
9 SASI_Mm02_00322156 predicted 336
10 SASI_Mm01_00058450 predicted 242
11 SASI_Mm01_00058444 predicted 445
12 SASI_Mm01_00058451 predicted 437
13 SASI_Mm01_00058452 predicted 450
14 SASI_Mm01_00058453 predicted 368
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000394
CRYAA MISSION shRNA Bacterial Glycerol Stock
crystallin, alpha A
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000412249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000394.2-581s21c1
Sequence:CCGGCCTCGTCCTAAGCAGGCATTGCTCGAGCAATGCCTGCTTAGGACGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000394.2-345s1c1
Sequence:CCGGCTTTGTGGAGATCCACGGAAACTCGAGTTTCCGTGGATCTCCACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000394.2-245s1c1
Sequence:CCGGCCGGCATCTCTGAGGTTCGATCTCGAGATCGAACCTCAGAGATGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000394.2-127s1c1
Sequence:CCGGAGCCGGCTGTTCGACCAGTTTCTCGAGAAACTGGTCGAACAGCCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000394.2-282s1c1
Sequence:CCGGCGTCATCTTCCTCGATGTGAACTCGAGTTCACATCGAGGAAGATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083358    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000394.2-700s1c1
Sequence:CCGGTCTCACATGGAATGAGGGTTTCTCGAGAAACCCTCATTCCATGTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000394
CRYAA MISSION shRNA shRNA Plasmid DNA
crystallin, alpha A
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000412249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000394.2-581s21c1
Sequence:CCGGCCTCGTCCTAAGCAGGCATTGCTCGAGCAATGCCTGCTTAGGACGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000394.2-345s1c1
Sequence:CCGGCTTTGTGGAGATCCACGGAAACTCGAGTTTCCGTGGATCTCCACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000394.2-245s1c1
Sequence:CCGGCCGGCATCTCTGAGGTTCGATCTCGAGATCGAACCTCAGAGATGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000394.2-127s1c1
Sequence:CCGGAGCCGGCTGTTCGACCAGTTTCTCGAGAAACTGGTCGAACAGCCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000394.2-282s1c1
Sequence:CCGGCGTCATCTTCCTCGATGTGAACTCGAGTTCACATCGAGGAAGATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083358    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000394.2-700s1c1
Sequence:CCGGTCTCACATGGAATGAGGGTTTCTCGAGAAACCCTCATTCCATGTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000394
CRYAA MISSION shRNA Lentiviral Transduction Particles
crystallin, alpha A
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000412249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000394.2-581s21c1
Sequence:CCGGCCTCGTCCTAAGCAGGCATTGCTCGAGCAATGCCTGCTTAGGACGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000394.2-345s1c1
Sequence:CCGGCTTTGTGGAGATCCACGGAAACTCGAGTTTCCGTGGATCTCCACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000394.2-245s1c1
Sequence:CCGGCCGGCATCTCTGAGGTTCGATCTCGAGATCGAACCTCAGAGATGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000394.2-127s1c1
Sequence:CCGGAGCCGGCTGTTCGACCAGTTTCTCGAGAAACTGGTCGAACAGCCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000394.2-282s1c1
Sequence:CCGGCGTCATCTTCCTCGATGTGAACTCGAGTTCACATCGAGGAAGATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083358    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000394.2-700s1c1
Sequence:CCGGTCTCACATGGAATGAGGGTTTCTCGAGAAACCCTCATTCCATGTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013501
CRYAA MISSION shRNA Bacterial Glycerol Stock
crystallin, alpha A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013501.1-378s1c1
Sequence:CCGGCGTGAAGGTACTGGAGGATTTCTCGAGAAATCCTCCAGTACCTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013501.1-439s1c1
Sequence:CCGGCATGGCTACATTTCCCGTGAACTCGAGTTCACGGGAAATGTAGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013501.1-245s1c1
Sequence:CCGGTGACCCATATGTGGTTTGTAACTCGAGTTACAAACCACATATGGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013501.1-321s1c1
Sequence:CCGGCCGGGACAAGTTTGTCATCTTCTCGAGAAGATGACAAACTTGTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013501.1-246s1c1
Sequence:CCGGGACCCATATGTGGTTTGTAATCTCGAGATTACAAACCACATATGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013501
CRYAA MISSION shRNA shRNA Plasmid DNA
crystallin, alpha A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013501.1-378s1c1
Sequence:CCGGCGTGAAGGTACTGGAGGATTTCTCGAGAAATCCTCCAGTACCTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013501.1-439s1c1
Sequence:CCGGCATGGCTACATTTCCCGTGAACTCGAGTTCACGGGAAATGTAGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013501.1-245s1c1
Sequence:CCGGTGACCCATATGTGGTTTGTAACTCGAGTTACAAACCACATATGGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013501.1-321s1c1
Sequence:CCGGCCGGGACAAGTTTGTCATCTTCTCGAGAAGATGACAAACTTGTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013501.1-246s1c1
Sequence:CCGGGACCCATATGTGGTTTGTAATCTCGAGATTACAAACCACATATGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013501
CRYAA MISSION shRNA Lentiviral Transduction Particles
crystallin, alpha A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013501.1-378s1c1
Sequence:CCGGCGTGAAGGTACTGGAGGATTTCTCGAGAAATCCTCCAGTACCTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013501.1-439s1c1
Sequence:CCGGCATGGCTACATTTCCCGTGAACTCGAGTTCACGGGAAATGTAGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013501.1-245s1c1
Sequence:CCGGTGACCCATATGTGGTTTGTAACTCGAGTTACAAACCACATATGGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013501.1-321s1c1
Sequence:CCGGCCGGGACAAGTTTGTCATCTTCTCGAGAAGATGACAAACTTGTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013501.1-246s1c1
Sequence:CCGGGACCCATATGTGGTTTGTAATCTCGAGATTACAAACCACATATGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks