EMAIL THIS PAGE TO A FRIEND

CRYAB

crystallin, alpha B

78 Gene Product Result for
Synonyms: CMD1II CRYA2 CTPP2 CTRCT16 HSPB5 MFM2
Gene ID:
Human(1410) Summary: Crystallins are separated into two classes: taxon-specific, or enzyme, and ubiquitous. The latter class constitutes the major proteins of vertebrate eye lens and maintains the transparency and refractive index of the lens. Since lens central fiber cells lose their nuclei during development, these crystallins are made and then retained throughout life, making them extremely stable proteins. Mammalian lens crystallins are divided into alpha, beta, and gamma families; beta and gamma crystallins are also considered as a superfamily. Alpha and beta families are further divided into acidic and basic groups. Seven protein regions exist in crystallins: four homologous motifs, a connecting peptide, and N- and C-terminal extensions. Alpha crystallins are composed of two gene products: alpha-A and alpha-B, for acidic and basic, respectively. Alpha crystallins can be induced by heat shock and are members of the small heat shock protein (sHSP also known as the HSP20) family. They act as molecular chaperones although they do not renature proteins and release them in the fashion of a true chaperone; instead they hold them in large soluble aggregates. Post-translational modifications decrease the ability to chaperone. These heterogeneous aggregates consist of 30-40 subunits; the alpha-A and alpha-B subunits have a 3:1 ratio, respectively. Two additional functions of alpha crystallins are an autokinase activity and participation in the intracellular architecture. Alpha-A and alpha-B gene products are differentially expressed; alpha-A is preferentially restricted to the lens and alpha-B is expressed widely in many tissues and organs. Elevated expression of alpha-B crystallin occurs in many neurological diseases; a missense mutation cosegregated in a family with a desmin-related myopathy. [provided by RefSeq, Jul 2008]
Mouse(12955) crystallin, alpha B
Rat(25420) crystallin, alpha B
naked mole-rat(101696917) crystallin, alpha B
domestic guinea pig(100306972) crystallin, alpha B
sheep(497274) crystallin, alpha B
Domestic Rabbit(100009295) crystallin, alpha B
chicken(396089) crystallin, alpha B
cow(281719) crystallin, alpha B
domestic cat(101092640) crystallin, alpha B
dog(479441) crystallin, alpha B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2500276 Anti-CRYAB antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, rat, human
ELISA, western blot pricing
AV48196 Anti-CRYAB antibody produced in rabbit IgG fraction of antiserum rat, canine, rabbit, human, sheep, pig, mouse, horse, bovine, guinea pig, rabbit
western blot pricing
HPA028724 Anti-CRYAB antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB4500485 Anti-CRYAB antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry pricing
SAB4500486 Anti-CRYAB antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB2106804 Anti-CRYAB antibody produced in rabbit affinity isolated antibody horse, rabbit, human, rat, sheep, guinea pig
ELISA, western blot pricing
HPA057100 Anti-CRYAB antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB4500484 Anti-CRYAB, N-Terminal antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
C7740 Anti-phospho-α-B Crystallin (14-25) (pSer19) antibody produced in rabbit affinity isolated antibody, lyophilized powder human, rat, bovine, mouse
immunofluorescence, immunohistochemistry, western blot pricing
C7990 Anti-phospho-α-B Crystallin (54-64) (pSer59) antibody produced in rabbit affinity isolated antibody, lyophilized powder bovine, human, rat
immunofluorescence, western blot pricing
SAB4504160 Anti-phospho-CRYAB (pSer19) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4504161 Anti-phospho-CRYAB (pSer45) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB4504162 Anti-phospho-CRYAB/Crystallin-α-B (pSer59) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry pricing
WH0001410M1 Monoclonal Anti-CRYAB antibody produced in mouse clone 1A10-1A4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1403696 Monoclonal Anti-CRYAB antibody produced in mouse clone 4E8-1C5, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB5300490 Monoclonal Anti-CRYAB antibody produced in mouse clone 1D11C6E6, ascites fluid human
ELISA, immunohistochemistry, western blot pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0925 AQUA Peptide VLGDVIEVHG[K] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009964 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009964 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009964 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001885 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001885 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001885 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001885 Rosetta Predictions human pricing
NM_012935 Rosetta Predictions rat pricing
NM_009964 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001885 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00235447 predicted 446
2 SASI_Hs01_00235449 predicted 393
3 SASI_Hs01_00235453 predicted 350
4 SASI_Hs01_00235455 predicted 345
5 SASI_Hs02_00332739 predicted 447
6 SASI_Hs02_00332740 predicted 398
7 SASI_Hs02_00332741 predicted 396
8 SASI_Hs01_00235446 predicted 248
9 SASI_Hs02_00332742 predicted 342
10 SASI_Hs02_00332743 predicted 294
11 SASI_Hs01_00235448 predicted 309
12 SASI_Hs01_00235450 predicted 295
13 SASI_Hs01_00235451 predicted 217
14 SASI_Hs01_00235452 predicted 238
15 SASI_Hs01_00235454 predicted 289
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012935 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00051992 predicted 246
2 SASI_Rn02_00260493 predicted 236
3 SASI_Rn01_00051993 predicted 393
4 SASI_Rn01_00051994 predicted 293
5 SASI_Rn01_00051996 predicted 268
6 SASI_Rn01_00051997 predicted 349
7 SASI_Rn01_00051998 predicted 342
8 SASI_Rn01_00051999 predicted 280
9 SASI_Rn01_00052000 predicted 326
10 SASI_Rn02_00260494 predicted 398
11 SASI_Rn01_00051991 predicted 748
12 SASI_Rn01_00051995 predicted 677
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009964 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00130172 predicted 607
2 SASI_Mm01_00130174 predicted 611
3 SASI_Mm01_00130175 predicted 709
4 SASI_Mm01_00130176 predicted 585
5 SASI_Mm01_00130177 predicted 776
6 SASI_Mm01_00130178 predicted 697
7 SASI_Mm01_00130179 predicted 730
8 SASI_Mm01_00130180 predicted 583
9 SASI_Mm01_00130181 predicted 696
10 SASI_Mm02_00317531 predicted 741
11 SASI_Mm01_00130173 predicted 624
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009964
VALIDATED
CRYAB MISSION shRNA Bacterial Glycerol Stock
crystallin, alpha B
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009964.1-707s1c1
Sequence:CCGGCCGGACTCTCAGAGATGCGTTCTCGAGAACGCATCTCTGAGAGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009964.1-817s1c1
Sequence:CCGGGTCCACGGCAAGCACGAAGAACTCGAGTTCTTCGTGCTTGCCGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009964.1-914s1c1
Sequence:CCGGCCATCACTTCATCCCTGTCATCTCGAGATGACAGGGATGAAGTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009964.1-947s1c1
Sequence:CCGGTCACTGTGAATGGACCAAGGACTCGAGTCCTTGGTCCATTCACAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009964.1-723s1c1
Sequence:CCGGGCGTTTGGAGAAGGACAGATTCTCGAGAATCTGTCCTTCTCCAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009964.2-817s21c1
Sequence:CCGGGTCCACGGCAAGCACGAAGAACTCGAGTTCTTCGTGCTTGCCGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009964.2-947s21c1
Sequence:CCGGTCACTGTGAATGGACCAAGGACTCGAGTCCTTGGTCCATTCACAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009964.2-707s21c1
Sequence:CCGGCCGGACTCTCAGAGATGCGTTCTCGAGAACGCATCTCTGAGAGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009964.2-914s21c1
Sequence:CCGGCCATCACTTCATCCCTGTCATCTCGAGATGACAGGGATGAAGTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009964
VALIDATED
CRYAB MISSION shRNA shRNA Plasmid DNA
crystallin, alpha B
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009964.1-707s1c1
Sequence:CCGGCCGGACTCTCAGAGATGCGTTCTCGAGAACGCATCTCTGAGAGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009964.1-817s1c1
Sequence:CCGGGTCCACGGCAAGCACGAAGAACTCGAGTTCTTCGTGCTTGCCGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009964.1-914s1c1
Sequence:CCGGCCATCACTTCATCCCTGTCATCTCGAGATGACAGGGATGAAGTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009964.1-947s1c1
Sequence:CCGGTCACTGTGAATGGACCAAGGACTCGAGTCCTTGGTCCATTCACAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009964.1-723s1c1
Sequence:CCGGGCGTTTGGAGAAGGACAGATTCTCGAGAATCTGTCCTTCTCCAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009964.2-817s21c1
Sequence:CCGGGTCCACGGCAAGCACGAAGAACTCGAGTTCTTCGTGCTTGCCGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009964.2-947s21c1
Sequence:CCGGTCACTGTGAATGGACCAAGGACTCGAGTCCTTGGTCCATTCACAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009964.2-707s21c1
Sequence:CCGGCCGGACTCTCAGAGATGCGTTCTCGAGAACGCATCTCTGAGAGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009964.2-914s21c1
Sequence:CCGGCCATCACTTCATCCCTGTCATCTCGAGATGACAGGGATGAAGTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009964
VALIDATED
CRYAB MISSION shRNA Lentiviral Transduction Particles
crystallin, alpha B
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009964.1-707s1c1
Sequence:CCGGCCGGACTCTCAGAGATGCGTTCTCGAGAACGCATCTCTGAGAGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009964.1-817s1c1
Sequence:CCGGGTCCACGGCAAGCACGAAGAACTCGAGTTCTTCGTGCTTGCCGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009964.1-914s1c1
Sequence:CCGGCCATCACTTCATCCCTGTCATCTCGAGATGACAGGGATGAAGTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009964.1-947s1c1
Sequence:CCGGTCACTGTGAATGGACCAAGGACTCGAGTCCTTGGTCCATTCACAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009964.1-723s1c1
Sequence:CCGGGCGTTTGGAGAAGGACAGATTCTCGAGAATCTGTCCTTCTCCAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009964.2-817s21c1
Sequence:CCGGGTCCACGGCAAGCACGAAGAACTCGAGTTCTTCGTGCTTGCCGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009964.2-947s21c1
Sequence:CCGGTCACTGTGAATGGACCAAGGACTCGAGTCCTTGGTCCATTCACAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009964.2-707s21c1
Sequence:CCGGCCGGACTCTCAGAGATGCGTTCTCGAGAACGCATCTCTGAGAGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009964.2-914s21c1
Sequence:CCGGCCATCACTTCATCCCTGTCATCTCGAGATGACAGGGATGAAGTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001885
CRYAB MISSION shRNA Bacterial Glycerol Stock
crystallin, alpha B
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001885.x-338s1c1
Sequence:CCGGGAAGAGCGCCAGGATGAACATCTCGAGATGTTCATCCTGGCGCTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001885.x-511s1c1
Sequence:CCGGCCGTGAAGAGAAGCCTGCTGTCTCGAGACAGCAGGCTTCTCTTCACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003841    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001885.x-650s1c1
Sequence:CCGGGCAGGCCCAAATTATCAAGCTCTCGAGAGCTTGATAATTTGGGCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001885.x-152s1c1
Sequence:CCGGTCCCTGAGTCCCTTCTACCTTCTCGAGAAGGTAGAAGGGACTCAGGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001885.x-420s1c1
Sequence:CCGGCCATTACTTCATCCCTGTCATCTCGAGATGACAGGGATGAAGTAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001885.1-313s21c1
Sequence:CCGGTGTGATTGAGGTGCATGGAAACTCGAGTTTCCATGCACCTCAATCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001885.1-250s21c1
Sequence:CCGGCTCTGTCAACCTGGATGTGAACTCGAGTTCACATCCAGGTTGACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001885.1-115s21c1
Sequence:CCGGGCACCTGTTGGAGTCTGATCTCTCGAGAGATCAGACTCCAACAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001885
CRYAB MISSION shRNA shRNA Plasmid DNA
crystallin, alpha B
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001885.x-338s1c1
Sequence:CCGGGAAGAGCGCCAGGATGAACATCTCGAGATGTTCATCCTGGCGCTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001885.x-511s1c1
Sequence:CCGGCCGTGAAGAGAAGCCTGCTGTCTCGAGACAGCAGGCTTCTCTTCACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003841    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001885.x-650s1c1
Sequence:CCGGGCAGGCCCAAATTATCAAGCTCTCGAGAGCTTGATAATTTGGGCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001885.x-152s1c1
Sequence:CCGGTCCCTGAGTCCCTTCTACCTTCTCGAGAAGGTAGAAGGGACTCAGGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001885.x-420s1c1
Sequence:CCGGCCATTACTTCATCCCTGTCATCTCGAGATGACAGGGATGAAGTAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001885.1-313s21c1
Sequence:CCGGTGTGATTGAGGTGCATGGAAACTCGAGTTTCCATGCACCTCAATCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001885.1-250s21c1
Sequence:CCGGCTCTGTCAACCTGGATGTGAACTCGAGTTCACATCCAGGTTGACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001885.1-115s21c1
Sequence:CCGGGCACCTGTTGGAGTCTGATCTCTCGAGAGATCAGACTCCAACAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001885
CRYAB MISSION shRNA Lentiviral Transduction Particles
crystallin, alpha B
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001885.x-338s1c1
Sequence:CCGGGAAGAGCGCCAGGATGAACATCTCGAGATGTTCATCCTGGCGCTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001885.x-511s1c1
Sequence:CCGGCCGTGAAGAGAAGCCTGCTGTCTCGAGACAGCAGGCTTCTCTTCACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003841    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001885.x-650s1c1
Sequence:CCGGGCAGGCCCAAATTATCAAGCTCTCGAGAGCTTGATAATTTGGGCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001885.x-152s1c1
Sequence:CCGGTCCCTGAGTCCCTTCTACCTTCTCGAGAAGGTAGAAGGGACTCAGGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001885.x-420s1c1
Sequence:CCGGCCATTACTTCATCCCTGTCATCTCGAGATGACAGGGATGAAGTAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001885.1-313s21c1
Sequence:CCGGTGTGATTGAGGTGCATGGAAACTCGAGTTTCCATGCACCTCAATCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001885.1-250s21c1
Sequence:CCGGCTCTGTCAACCTGGATGTGAACTCGAGTTCACATCCAGGTTGACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001885.1-115s21c1
Sequence:CCGGGCACCTGTTGGAGTCTGATCTCTCGAGAGATCAGACTCCAACAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks