EMAIL THIS PAGE TO A FRIEND

CRYBA1

crystallin, beta A1

52 Gene Product Result for
Synonyms: CRYB1 CTRCT10
UniProtKB ID: P05813, Q13633, Q14CM9
Gene ID:
Human(1411) Summary: Crystallins are separated into two classes: taxon-specific, or enzyme, and ubiquitous. The latter class constitutes the major proteins of vertebrate eye lens and maintains the transparency and refractive index of the lens. Since lens central fiber cells lose their nuclei during development, these crystallins are made and then retained throughout life, making them extremely stable proteins. Mammalian lens crystallins are divided into alpha, beta, and gamma families; beta and gamma crystallins are also considered as a superfamily. Alpha and beta families are further divided into acidic and basic groups. Seven protein regions exist in crystallins: four homologous motifs, a connecting peptide, and N- and C-terminal extensions. Beta-crystallins, the most heterogeneous, differ by the presence of the C-terminal extension (present in the basic group, none in the acidic group). Beta-crystallins form aggregates of different sizes and are able to self-associate to form dimers or to form heterodimers with other beta-crystallins. This gene, a beta acidic group member, encodes two proteins (crystallin, beta A3 and crystallin, beta A1) from a single mRNA, the latter protein is 17 aa shorter than crystallin, beta A3 and is generated by use of an alternate translation initiation site. Deletion of exons 3 and 4 causes the autosomal dominant disease 'zonular cataract with sutural opacities'. [provided by RefSeq, Jul 2008]
Mouse(12957) crystallin, beta A1
Rat(25583) crystallin, beta A1
chicken(396499) crystallin, beta A1
dog(491178) crystallin, beta A1
domestic cat(101093724) crystallin, beta A1
cow(282202) crystallin, beta A1
sheep(101109193) crystallin, beta A1
domestic guinea pig(100379565) crystallin, beta A1
naked mole-rat(101696796) crystallin, beta A1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1303654 ANTI-CRYBA1 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
immunohistochemistry, western blot pricing
SAB2700408 Anti-CRYBA1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB2103735 Anti-CRYBA1, (N-terminal) antibody produced in rabbit affinity isolated antibody canine, zebrafish, guinea pig, rabbit, mouse, rat, horse, human, rabbit, bovine
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009965 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009965 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009965 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005208 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005208 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005208 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU089731 MISSION® esiRNA esiRNA targeting mouse Cryba1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005208 Rosetta Predictions human pricing
XM_001080813 Rosetta Predictions rat pricing
XM_340846 Rosetta Predictions rat pricing
NM_009965 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005208 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200597 predicted 525
2 SASI_Hs01_00200598 predicted 528
3 SASI_Hs01_00200599 predicted 214
4 SASI_Hs01_00200600 predicted 245
5 SASI_Hs01_00200601 predicted 472
6 SASI_Hs01_00200602 predicted 371
7 SASI_Hs01_00200603 predicted 361
8 SASI_Hs01_00200604 predicted 537
9 SASI_Hs02_00339181 predicted 504
10 SASI_Hs01_00200605 predicted 371
11 SASI_Hs01_00200606 predicted 534
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080813 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00369472 predicted 533
2 SASI_Rn02_00369473 predicted 393
3 SASI_Rn02_00369474 predicted 534
4 SASI_Rn02_00369475 predicted 447
5 SASI_Rn02_00369476 predicted 539
6 SASI_Rn02_00369477 predicted 375
7 SASI_Rn02_00369478 predicted 305
8 SASI_Rn02_00369479 predicted 343
9 SASI_Rn02_00369480 predicted 316
10 SASI_Rn02_00369481 predicted 515
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_340846 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00392009 predicted 527
2 SASI_Rn02_00392010 predicted 393
3 SASI_Rn02_00392011 predicted 539
4 SASI_Rn02_00392012 predicted 449
5 SASI_Rn02_00392013 predicted 536
6 SASI_Rn02_00392014 predicted 381
7 SASI_Rn02_00392015 predicted 312
8 SASI_Rn02_00392016 predicted 348
9 SASI_Rn02_00392017 predicted 320
10 SASI_Rn02_00392018 predicted 522
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009965 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00063035 predicted 387
2 SASI_Mm01_00063036 predicted 310
3 SASI_Mm01_00063037 predicted 345
4 SASI_Mm01_00063038 predicted 354
5 SASI_Mm01_00063039 predicted 304
6 SASI_Mm01_00063040 predicted 448
7 SASI_Mm01_00063041 predicted 327
8 SASI_Mm01_00063042 predicted 358
9 SASI_Mm01_00063043 predicted 316
10 SASI_Mm01_00063044 predicted 378
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009965
CRYBA1 MISSION shRNA Bacterial Glycerol Stock
crystallin, beta A1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009965.1-366s1c1
Sequence:CCGGCGCTAATCATAAAGAGTCTAACTCGAGTTAGACTCTTTATGATTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009965.1-396s1c1
Sequence:CCGGCTTCGAGAAAGAGAACTTTATCTCGAGATAAAGTTCTCTTTCTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009965.1-311s1c1
Sequence:CCGGGCGGGAGCAATGCCTATCATACTCGAGTATGATAGGCATTGCTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009965.1-168s1c1
Sequence:CCGGCCCAAATGTCTCTGAACGTAACTCGAGTTACGTTCAGAGACATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009965.1-312s1c1
Sequence:CCGGCGGGAGCAATGCCTATCATATCTCGAGATATGATAGGCATTGCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009965
CRYBA1 MISSION shRNA shRNA Plasmid DNA
crystallin, beta A1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009965.1-366s1c1
Sequence:CCGGCGCTAATCATAAAGAGTCTAACTCGAGTTAGACTCTTTATGATTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009965.1-396s1c1
Sequence:CCGGCTTCGAGAAAGAGAACTTTATCTCGAGATAAAGTTCTCTTTCTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009965.1-311s1c1
Sequence:CCGGGCGGGAGCAATGCCTATCATACTCGAGTATGATAGGCATTGCTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009965.1-168s1c1
Sequence:CCGGCCCAAATGTCTCTGAACGTAACTCGAGTTACGTTCAGAGACATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009965.1-312s1c1
Sequence:CCGGCGGGAGCAATGCCTATCATATCTCGAGATATGATAGGCATTGCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009965
CRYBA1 MISSION shRNA Lentiviral Transduction Particles
crystallin, beta A1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009965.1-366s1c1
Sequence:CCGGCGCTAATCATAAAGAGTCTAACTCGAGTTAGACTCTTTATGATTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009965.1-396s1c1
Sequence:CCGGCTTCGAGAAAGAGAACTTTATCTCGAGATAAAGTTCTCTTTCTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009965.1-311s1c1
Sequence:CCGGGCGGGAGCAATGCCTATCATACTCGAGTATGATAGGCATTGCTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009965.1-168s1c1
Sequence:CCGGCCCAAATGTCTCTGAACGTAACTCGAGTTACGTTCAGAGACATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009965.1-312s1c1
Sequence:CCGGCGGGAGCAATGCCTATCATATCTCGAGATATGATAGGCATTGCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005208
CRYBA1 MISSION shRNA Bacterial Glycerol Stock
crystallin, beta A1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005208.3-506s1c1
Sequence:CCGGGCCTGGGTTTGCTACCAATATCTCGAGATATTGGTAGCAAACCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005208.3-98s1c1
Sequence:CCGGTGGAAGATAACCATCTATGATCTCGAGATCATAGATGGTTATCTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005208.3-352s1c1
Sequence:CCGGCATCTGTTCAGCTAATCATAACTCGAGTTATGATTAGCTGAACAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005208.3-95s1c1
Sequence:CCGGCCATGGAAGATAACCATCTATCTCGAGATAGATGGTTATCTTCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005208.3-351s1c1
Sequence:CCGGCCATCTGTTCAGCTAATCATACTCGAGTATGATTAGCTGAACAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005208
CRYBA1 MISSION shRNA shRNA Plasmid DNA
crystallin, beta A1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005208.3-506s1c1
Sequence:CCGGGCCTGGGTTTGCTACCAATATCTCGAGATATTGGTAGCAAACCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005208.3-98s1c1
Sequence:CCGGTGGAAGATAACCATCTATGATCTCGAGATCATAGATGGTTATCTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005208.3-352s1c1
Sequence:CCGGCATCTGTTCAGCTAATCATAACTCGAGTTATGATTAGCTGAACAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005208.3-95s1c1
Sequence:CCGGCCATGGAAGATAACCATCTATCTCGAGATAGATGGTTATCTTCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005208.3-351s1c1
Sequence:CCGGCCATCTGTTCAGCTAATCATACTCGAGTATGATTAGCTGAACAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005208
CRYBA1 MISSION shRNA Lentiviral Transduction Particles
crystallin, beta A1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005208.3-506s1c1
Sequence:CCGGGCCTGGGTTTGCTACCAATATCTCGAGATATTGGTAGCAAACCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005208.3-98s1c1
Sequence:CCGGTGGAAGATAACCATCTATGATCTCGAGATCATAGATGGTTATCTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005208.3-352s1c1
Sequence:CCGGCATCTGTTCAGCTAATCATAACTCGAGTTATGATTAGCTGAACAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005208.3-95s1c1
Sequence:CCGGCCATGGAAGATAACCATCTATCTCGAGATAGATGGTTATCTTCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005208.3-351s1c1
Sequence:CCGGCCATCTGTTCAGCTAATCATACTCGAGTATGATTAGCTGAACAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks