EMAIL THIS PAGE TO A FRIEND

CRYBA2

crystallin, beta A2

73 Gene Product Result for
UniProtKB ID: P53672, Q4ZFX0, Q9Y562
Gene ID:
Human(1412) Summary: Crystallins are separated into two classes: taxon-specific, or enzyme, and ubiquitous. The latter class constitutes the major proteins of the vertebrate eye, which function to maintain the transparency and refractive index of the lens. Since lens central fiber cells lose their nuclei during development, these crystallins are made and then retained throughout life, making them extremely stable proteins. Mammalian lens crystallins are divided into alpha, beta, and gamma families; beta and gamma crystallins are also defined as a superfamily. Alpha and beta families are further divided into acidic and basic groups. Seven protein regions exist in crystallins: four homologous motifs, a connecting peptide, and N- and C-terminal extensions. Beta-crystallins, the most heterogeneous, differ by the presence of the C-terminal extension (present in the basic group but absent in the acidic group). Beta-crystallins form aggregates of different sizes and are able to form homodimers through self-association or heterodimers with other beta-crystallins. This gene is a beta acidic group member. Three alternatively spliced transcript variants encoding identical proteins have been reported. [provided by RefSeq, Jul 2008]
Mouse(12958) crystallin, beta A2
Rat(286925) crystallin, beta A2
chicken(373999) crystallin, beta A2
dog(488531) crystallin, beta A2
cow(282203) crystallin, beta A2
domestic cat(101092706) crystallin, beta A2
naked mole-rat(101698197) crystallin, beta A2
domestic guinea pig(100306966) crystallin, beta A2
sheep(101112297) crystallin, beta A2
Domestic Rabbit(100101619) crystallin, beta A2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021541 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021541 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021541 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005209 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005209 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005209 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_057093 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_057093 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_057093 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU063381 MISSION® esiRNA esiRNA human CRYBA2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005209 Rosetta Predictions human pricing
NM_057093 Rosetta Predictions human pricing
NM_057094 Rosetta Predictions human pricing
NM_173140 Rosetta Predictions rat pricing
NM_021541 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005209 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00069162 predicted 435
2 SASI_Hs02_00339182 predicted 317
3 SASI_Hs01_00069163 predicted 331
4 SASI_Hs01_00069164 predicted 388
5 SASI_Hs01_00069165 predicted 431
6 SASI_Hs01_00069166 predicted 380
7 SASI_Hs01_00069168 predicted 376
8 SASI_Hs01_00069169 predicted 443
9 SASI_Hs01_00069170 predicted 389
10 SASI_Hs01_00069171 predicted 383
11 SASI_Hs01_00069167 predicted 291
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057093 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00112764 predicted 638
2 SASI_Hs02_00362003 predicted 514
3 SASI_Hs01_00112765 predicted 533
4 SASI_Hs01_00112766 predicted 590
5 SASI_Hs01_00112767 predicted 631
6 SASI_Hs01_00112768 predicted 576
7 SASI_Hs01_00112770 predicted 583
8 SASI_Hs01_00112771 predicted 645
9 SASI_Hs01_00112772 predicted 589
10 SASI_Hs01_00112773 predicted 588
11 SASI_Hs01_00112769 predicted 499
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057094 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00118626 predicted 444
2 SASI_Hs02_00362004 predicted 325
3 SASI_Hs01_00118627 predicted 339
4 SASI_Hs01_00118628 predicted 393
5 SASI_Hs01_00118629 predicted 438
6 SASI_Hs01_00118630 predicted 381
7 SASI_Hs01_00118632 predicted 387
8 SASI_Hs01_00118633 predicted 447
9 SASI_Hs01_00118634 predicted 400
10 SASI_Hs01_00118635 predicted 392
11 SASI_Hs01_00118631 predicted 299
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173140 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00034891 predicted 298
2 SASI_Rn01_00034892 predicted 443
3 SASI_Rn01_00034894 predicted 374
4 SASI_Rn01_00034895 predicted 384
5 SASI_Rn01_00034896 predicted 229
6 SASI_Rn01_00034897 predicted 274
7 SASI_Rn01_00034898 predicted 321
8 SASI_Rn01_00034899 predicted 253
9 SASI_Rn01_00034900 predicted 250
10 SASI_Rn02_00269318 predicted 420
11 SASI_Rn01_00034893 predicted 351
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021541 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00027423 predicted 322
2 SASI_Mm02_00326285 predicted 413
3 SASI_Mm01_00027424 predicted 218
4 SASI_Mm01_00027425 predicted 371
5 SASI_Mm01_00027426 predicted 253
6 SASI_Mm02_00326286 predicted 307
7 SASI_Mm02_00326287 predicted 245
8 SASI_Mm02_00326288 predicted 449
9 SASI_Mm01_00027430 predicted 282
10 SASI_Mm01_00027431 predicted 424
11 SASI_Mm01_00027427 predicted 216
12 SASI_Mm01_00027428 predicted 369
13 SASI_Mm01_00027429 predicted 421
14 SASI_Mm01_00027432 predicted 225
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021541
CRYBA2 MISSION shRNA Bacterial Glycerol Stock
crystallin, beta A2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021541.1-537s1c1
Sequence:CCGGCCGAGGTTACCAGTATGTCTTCTCGAGAAGACATACTGGTAACCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021541.1-253s1c1
Sequence:CCGGCAGGGACAGCAGTTCATTCTACTCGAGTAGAATGAACTGCTGTCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021541.1-542s1c1
Sequence:CCGGGTTACCAGTATGTCTTAGAAACTCGAGTTTCTAAGACATACTGGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021541.1-327s1c1
Sequence:CCGGCAGCAACCAATTGCTGTCCTTCTCGAGAAGGACAGCAATTGGTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021541.1-430s1c1
Sequence:CCGGCTCAGTGATGACTACCCATCACTCGAGTGATGGGTAGTCATCACTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021541
CRYBA2 MISSION shRNA shRNA Plasmid DNA
crystallin, beta A2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021541.1-537s1c1
Sequence:CCGGCCGAGGTTACCAGTATGTCTTCTCGAGAAGACATACTGGTAACCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021541.1-253s1c1
Sequence:CCGGCAGGGACAGCAGTTCATTCTACTCGAGTAGAATGAACTGCTGTCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021541.1-542s1c1
Sequence:CCGGGTTACCAGTATGTCTTAGAAACTCGAGTTTCTAAGACATACTGGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021541.1-327s1c1
Sequence:CCGGCAGCAACCAATTGCTGTCCTTCTCGAGAAGGACAGCAATTGGTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021541.1-430s1c1
Sequence:CCGGCTCAGTGATGACTACCCATCACTCGAGTGATGGGTAGTCATCACTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021541
CRYBA2 MISSION shRNA Lentiviral Transduction Particles
crystallin, beta A2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021541.1-537s1c1
Sequence:CCGGCCGAGGTTACCAGTATGTCTTCTCGAGAAGACATACTGGTAACCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021541.1-253s1c1
Sequence:CCGGCAGGGACAGCAGTTCATTCTACTCGAGTAGAATGAACTGCTGTCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021541.1-542s1c1
Sequence:CCGGGTTACCAGTATGTCTTAGAAACTCGAGTTTCTAAGACATACTGGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021541.1-327s1c1
Sequence:CCGGCAGCAACCAATTGCTGTCCTTCTCGAGAAGGACAGCAATTGGTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021541.1-430s1c1
Sequence:CCGGCTCAGTGATGACTACCCATCACTCGAGTGATGGGTAGTCATCACTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005209
CRYBA2 MISSION shRNA Bacterial Glycerol Stock
crystallin, beta A2
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000181083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005209.1-371s1c1
Sequence:CCGGCAACTTCCAAGGCTGCAAGTTCTCGAGAACTTGCAGCCTTGGAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180946    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005209.1-548s1c1
Sequence:CCGGGTTCTGTACTTACGGTGAGCTCTCGAGAGCTCACCGTAAGTACAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219812    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005209.1-217s1c1
Sequence:CCGGTCCAGGGACAGCAGTTCATTCCTCGAGGAATGAACTGCTGTCCCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219813    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005209.1-343s1c1
Sequence:CCGGACAGCCGTGTGACACTGTTTGCTCGAGCAAACAGTGTCACACGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005209
CRYBA2 MISSION shRNA shRNA Plasmid DNA
crystallin, beta A2
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000181083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005209.1-371s1c1
Sequence:CCGGCAACTTCCAAGGCTGCAAGTTCTCGAGAACTTGCAGCCTTGGAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180946    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005209.1-548s1c1
Sequence:CCGGGTTCTGTACTTACGGTGAGCTCTCGAGAGCTCACCGTAAGTACAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219812    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005209.1-217s1c1
Sequence:CCGGTCCAGGGACAGCAGTTCATTCCTCGAGGAATGAACTGCTGTCCCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219813    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005209.1-343s1c1
Sequence:CCGGACAGCCGTGTGACACTGTTTGCTCGAGCAAACAGTGTCACACGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005209
CRYBA2 MISSION shRNA Lentiviral Transduction Particles
crystallin, beta A2
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000181083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005209.1-371s1c1
Sequence:CCGGCAACTTCCAAGGCTGCAAGTTCTCGAGAACTTGCAGCCTTGGAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180946    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005209.1-548s1c1
Sequence:CCGGGTTCTGTACTTACGGTGAGCTCTCGAGAGCTCACCGTAAGTACAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219812    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005209.1-217s1c1
Sequence:CCGGTCCAGGGACAGCAGTTCATTCCTCGAGGAATGAACTGCTGTCCCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219813    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005209.1-343s1c1
Sequence:CCGGACAGCCGTGTGACACTGTTTGCTCGAGCAAACAGTGTCACACGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_057093
CRYBA2 MISSION shRNA Bacterial Glycerol Stock
crystallin, beta A2
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000180738    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_057093.1-746s1c1
Sequence:CCGGGAGTTCTGTACTTACGGTGAGCTCGAGCTCACCGTAAGTACAGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_057093.1-642s21c1
Sequence:CCGGAGGATGTGGGTTCCCTCAAAGCTCGAGCTTTGAGGGAACCCACATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_057093.1-594s21c1
Sequence:CCGGACCTCGTTGATGACTACCCATCTCGAGATGGGTAGTCATCAACGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_057093
CRYBA2 MISSION shRNA shRNA Plasmid DNA
crystallin, beta A2
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000180738    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_057093.1-746s1c1
Sequence:CCGGGAGTTCTGTACTTACGGTGAGCTCGAGCTCACCGTAAGTACAGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_057093.1-642s21c1
Sequence:CCGGAGGATGTGGGTTCCCTCAAAGCTCGAGCTTTGAGGGAACCCACATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_057093.1-594s21c1
Sequence:CCGGACCTCGTTGATGACTACCCATCTCGAGATGGGTAGTCATCAACGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_057093
CRYBA2 MISSION shRNA Lentiviral Transduction Particles
crystallin, beta A2
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000180738    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_057093.1-746s1c1
Sequence:CCGGGAGTTCTGTACTTACGGTGAGCTCGAGCTCACCGTAAGTACAGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_057093.1-642s21c1
Sequence:CCGGAGGATGTGGGTTCCCTCAAAGCTCGAGCTTTGAGGGAACCCACATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_057093.1-594s21c1
Sequence:CCGGACCTCGTTGATGACTACCCATCTCGAGATGGGTAGTCATCAACGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks