EMAIL THIS PAGE TO A FRIEND

CRYBA4

crystallin, beta A4

48 Gene Product Result for
Synonyms: CTRCT23 MCOPCT4
UniProtKB ID: P53673, Q4VB22, Q6ICE4
Gene ID:
Human(1413) Summary: Crystallins are separated into two classes: taxon-specific, or enzyme, and ubiquitous. The latter class constitutes the major proteins of vertebrate eye lens and maintains the transparency and refractive index of the lens. Since lens central fiber cells lose their nuclei during development, these crystallins are made and then retained throughout life, making them extremely stable proteins. Mammalian lens crystallins are divided into alpha, beta, and gamma families; beta and gamma crystallins are also considered as a superfamily. Alpha and beta families are further divided into acidic and basic groups. Seven protein regions exist in crystallins: four homologous motifs, a connecting peptide, and N- and C-terminal extensions. Beta-crystallins, the most heterogeneous, differ by the presence of the C-terminal extension (present in the basic group, none in the acidic group). Beta-crystallins form aggregates of different sizes and are able to self-associate to form dimers or to form heterodimers with other beta-crystallins. This gene, a beta acidic group member, is part of a gene cluster with beta-B1, beta-B2, and beta-B3. [provided by RefSeq, Jul 2008]
Mouse(12959) crystallin, beta A4
Rat(64348) crystallin, beta A4
Zebrafish(553178) crystallin, beta A4
dog(486334) crystallin, beta A4
cow(282204) crystallin, beta A4
domestic cat(101084745) crystallin, beta A4
chicken(373998) crystallin, beta A4
sheep(101105105) crystallin, beta A4
domestic guinea pig(100306973) crystallin, beta A4
naked mole-rat(101718288) crystallin, beta A4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001886 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001886 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001886 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021351 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021351 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021351 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU153311 MISSION® esiRNA esiRNA human CRYBA4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001886 Rosetta Predictions human pricing
NM_031689 Rosetta Predictions rat pricing
NM_021351 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001886 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332744 predicted 342
2 SASI_Hs01_00082979 predicted 536
3 SASI_Hs01_00082981 predicted 236
4 SASI_Hs02_00332745 predicted 348
5 SASI_Hs01_00082983 predicted 514
6 SASI_Hs01_00082984 predicted 211
7 SASI_Hs02_00332746 predicted 216
8 SASI_Hs02_00332747 predicted 392
9 SASI_Hs01_00082986 predicted 501
10 SASI_Hs02_00332748 predicted 477
11 SASI_Hs01_00082977 predicted 433
12 SASI_Hs01_00082978 predicted 354
13 SASI_Hs01_00082980 predicted 208
14 SASI_Hs01_00082982 predicted 339
15 SASI_Hs01_00082985 predicted 441
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031689 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00073336 predicted 465
2 SASI_Rn01_00073337 predicted 339
3 SASI_Rn02_00265032 predicted 447
4 SASI_Rn01_00073338 predicted 397
5 SASI_Rn01_00073339 predicted 437
6 SASI_Rn01_00073340 predicted 474
7 SASI_Rn01_00073341 predicted 483
8 SASI_Rn01_00073342 predicted 525
9 SASI_Rn01_00073343 predicted 336
10 SASI_Rn01_00073344 predicted 362
11 SASI_Rn01_00073345 predicted 491
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021351 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00325934 predicted 517
2 SASI_Mm01_00041696 predicted 438
3 SASI_Mm01_00041697 predicted 331
4 SASI_Mm01_00041698 predicted 517
5 SASI_Mm01_00041699 predicted 461
6 SASI_Mm01_00041700 predicted 237
7 SASI_Mm01_00041701 predicted 388
8 SASI_Mm01_00041702 predicted 328
9 SASI_Mm01_00041703 predicted 508
10 SASI_Mm01_00041704 predicted 202
11 SASI_Mm01_00041705 predicted 363
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001886
CRYBA4 MISSION shRNA Bacterial Glycerol Stock
crystallin, beta A4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001886.1-156s1c1
Sequence:CCGGCTTCGAGACTGTGCGATCTTTCTCGAGAAAGATCGCACAGTCTCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156335    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001886.1-444s1c1
Sequence:CCGGCAATGAAGTAGGGTCCTTCCACTCGAGTGGAAGGACCCTACTTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154150    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001886.1-169s1c1
Sequence:CCGGCGATCTTTGAAAGTGCTGAGTCTCGAGACTCAGCACTTTCAAAGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001886.1-541s1c1
Sequence:CCGGCATTCCGGTGACTACAAACATCTCGAGATGTTTGTAGTCACCGGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152441    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001886.1-360s1c1
Sequence:CCGGCATCTTCGAGCAAGAGAACTTCTCGAGAAGTTCTCTTGCTCGAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001886.1-162s1c1
Sequence:CCGGGACTGTGCGATCTTTGAAAGTCTCGAGACTTTCAAAGATCGCACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157859    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001886.1-652s1c1
Sequence:CCGGCATGCGTGCCTTATCTGCAATCTCGAGATTGCAGATAAGGCACGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001886.1-517s1c1
Sequence:CCGGCAGTATGTGCTGGAATGCGATCTCGAGATCGCATTCCAGCACATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001886.1-507s1c1
Sequence:CCGGCCGAGGATTTCAGTATGTGCTCTCGAGAGCACATACTGAAATCCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001886
CRYBA4 MISSION shRNA shRNA Plasmid DNA
crystallin, beta A4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001886.1-156s1c1
Sequence:CCGGCTTCGAGACTGTGCGATCTTTCTCGAGAAAGATCGCACAGTCTCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156335    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001886.1-444s1c1
Sequence:CCGGCAATGAAGTAGGGTCCTTCCACTCGAGTGGAAGGACCCTACTTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154150    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001886.1-169s1c1
Sequence:CCGGCGATCTTTGAAAGTGCTGAGTCTCGAGACTCAGCACTTTCAAAGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001886.1-541s1c1
Sequence:CCGGCATTCCGGTGACTACAAACATCTCGAGATGTTTGTAGTCACCGGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152441    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001886.1-360s1c1
Sequence:CCGGCATCTTCGAGCAAGAGAACTTCTCGAGAAGTTCTCTTGCTCGAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001886.1-162s1c1
Sequence:CCGGGACTGTGCGATCTTTGAAAGTCTCGAGACTTTCAAAGATCGCACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157859    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001886.1-652s1c1
Sequence:CCGGCATGCGTGCCTTATCTGCAATCTCGAGATTGCAGATAAGGCACGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001886.1-517s1c1
Sequence:CCGGCAGTATGTGCTGGAATGCGATCTCGAGATCGCATTCCAGCACATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001886.1-507s1c1
Sequence:CCGGCCGAGGATTTCAGTATGTGCTCTCGAGAGCACATACTGAAATCCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001886
CRYBA4 MISSION shRNA Lentiviral Transduction Particles
crystallin, beta A4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001886.1-156s1c1
Sequence:CCGGCTTCGAGACTGTGCGATCTTTCTCGAGAAAGATCGCACAGTCTCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156335    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001886.1-444s1c1
Sequence:CCGGCAATGAAGTAGGGTCCTTCCACTCGAGTGGAAGGACCCTACTTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154150    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001886.1-169s1c1
Sequence:CCGGCGATCTTTGAAAGTGCTGAGTCTCGAGACTCAGCACTTTCAAAGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001886.1-541s1c1
Sequence:CCGGCATTCCGGTGACTACAAACATCTCGAGATGTTTGTAGTCACCGGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152441    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001886.1-360s1c1
Sequence:CCGGCATCTTCGAGCAAGAGAACTTCTCGAGAAGTTCTCTTGCTCGAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001886.1-162s1c1
Sequence:CCGGGACTGTGCGATCTTTGAAAGTCTCGAGACTTTCAAAGATCGCACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157859    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001886.1-652s1c1
Sequence:CCGGCATGCGTGCCTTATCTGCAATCTCGAGATTGCAGATAAGGCACGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001886.1-517s1c1
Sequence:CCGGCAGTATGTGCTGGAATGCGATCTCGAGATCGCATTCCAGCACATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001886.1-507s1c1
Sequence:CCGGCCGAGGATTTCAGTATGTGCTCTCGAGAGCACATACTGAAATCCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021351
CRYBA4 MISSION shRNA Bacterial Glycerol Stock
crystallin, beta A4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021351.1-465s1c1
Sequence:CCGGGCGTGGGTTTGTTCCCAGTTTCTCGAGAAACTGGGAACAAACCCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021351.1-530s1c1
Sequence:CCGGCTCAGGTGACTACAAGCACTTCTCGAGAAGTGCTTGTAGTCACCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021351.1-329s1c1
Sequence:CCGGCCGCGACTCAAGGCTGACCATCTCGAGATGGTCAGCCTTGAGTCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021351.1-212s1c1
Sequence:CCGGAGGACAGCAATATGTGCTGGACTCGAGTCCAGCACATATTGCTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021351.1-98s1c1
Sequence:CCGGACGGCATGAATTCACAGCTGACTCGAGTCAGCTGTGAATTCATGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021351
CRYBA4 MISSION shRNA shRNA Plasmid DNA
crystallin, beta A4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021351.1-465s1c1
Sequence:CCGGGCGTGGGTTTGTTCCCAGTTTCTCGAGAAACTGGGAACAAACCCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021351.1-530s1c1
Sequence:CCGGCTCAGGTGACTACAAGCACTTCTCGAGAAGTGCTTGTAGTCACCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021351.1-329s1c1
Sequence:CCGGCCGCGACTCAAGGCTGACCATCTCGAGATGGTCAGCCTTGAGTCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021351.1-212s1c1
Sequence:CCGGAGGACAGCAATATGTGCTGGACTCGAGTCCAGCACATATTGCTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021351.1-98s1c1
Sequence:CCGGACGGCATGAATTCACAGCTGACTCGAGTCAGCTGTGAATTCATGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021351
CRYBA4 MISSION shRNA Lentiviral Transduction Particles
crystallin, beta A4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021351.1-465s1c1
Sequence:CCGGGCGTGGGTTTGTTCCCAGTTTCTCGAGAAACTGGGAACAAACCCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021351.1-530s1c1
Sequence:CCGGCTCAGGTGACTACAAGCACTTCTCGAGAAGTGCTTGTAGTCACCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021351.1-329s1c1
Sequence:CCGGCCGCGACTCAAGGCTGACCATCTCGAGATGGTCAGCCTTGAGTCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021351.1-212s1c1
Sequence:CCGGAGGACAGCAATATGTGCTGGACTCGAGTCCAGCACATATTGCTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021351.1-98s1c1
Sequence:CCGGACGGCATGAATTCACAGCTGACTCGAGTCAGCTGTGAATTCATGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks