EMAIL THIS PAGE TO A FRIEND

CRYBB1

crystallin, beta B1

48 Gene Product Result for
Synonyms: CATCN3 CTRCT17
UniProtKB ID: P53674
Gene ID:
Human(1414) Summary: Crystallins are separated into two classes: taxon-specific, or enzyme, and ubiquitous. The latter class constitutes the major proteins of vertebrate eye lens and maintains the transparency and refractive index of the lens. Since lens central fiber cells lose their nuclei during development, these crystallins are made and then retained throughout life, making them extremely stable proteins. Mammalian lens crystallins are divided into alpha, beta, and gamma families; beta and gamma crystallins are also considered as a superfamily. Alpha and beta families are further divided into acidic and basic groups. Seven protein regions exist in crystallins: four homologous motifs, a connecting peptide, and N- and C-terminal extensions. Beta-crystallins, the most heterogeneous, differ by the presence of the C-terminal extension (present in the basic group, none in the acidic group). Beta-crystallins form aggregates of different sizes and are able to self-associate to form dimers or to form heterodimers with other beta-crystallins. This gene, a beta basic group member, undergoes extensive cleavage at its N-terminal extension during lens maturation. It is also a member of a gene cluster with beta-A4, beta-B2, and beta-B3. [provided by RefSeq, Jul 2008]
Mouse(12960) crystallin, beta B1
Rat(25421) crystallin, beta B1
naked mole-rat(101717949) crystallin, beta B1
domestic guinea pig(100307054) crystallin, beta B1
sheep(101118903) crystallin, beta B1
Zebrafish(114418) crystallin, beta B1
chicken(374000) crystallin, beta B1
cow(282205) crystallin, beta B1
domestic cat(101084490) crystallin, beta B1
dog(486333) crystallin, beta B1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023695 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023695 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023695 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001887 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001887 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001887 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU003461 MISSION® esiRNA esiRNA targeting mouse Crybb1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001887 Rosetta Predictions human pricing
NM_012936 Rosetta Predictions rat pricing
NM_023695 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001887 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00013471 predicted 456
2 SASI_Hs01_00013472 predicted 635
3 SASI_Hs01_00013473 predicted 427
4 SASI_Hs01_00013474 predicted 421
5 SASI_Hs02_00332749 predicted 694
6 SASI_Hs01_00013475 predicted 592
7 SASI_Hs01_00013476 predicted 458
8 SASI_Hs01_00013477 predicted 688
9 SASI_Hs01_00013478 predicted 690
10 SASI_Hs01_00013479 predicted 419
11 SASI_Hs01_00013480 predicted 381
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012936 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00260495 predicted 653
2 SASI_Rn02_00260496 predicted 310
3 SASI_Rn02_00260497 predicted 683
4 SASI_Rn02_00260498 predicted 305
5 SASI_Rn01_00079277 predicted 663
6 SASI_Rn02_00260499 predicted 703
7 SASI_Rn01_00079279 predicted 656
8 SASI_Rn02_00260500 predicted 728
9 SASI_Rn01_00079282 predicted 572
10 SASI_Rn02_00260501 predicted 738
11 SASI_Rn01_00079275 predicted 383
12 SASI_Rn01_00079276 predicted 426
13 SASI_Rn01_00079278 predicted 471
14 SASI_Rn01_00079280 predicted 441
15 SASI_Rn01_00079281 predicted 255
16 SASI_Rn01_00079283 predicted 414
17 SASI_Rn01_00079284 predicted 483
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023695 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00072690 predicted 459
2 SASI_Mm01_00072691 predicted 204
3 SASI_Mm01_00072692 predicted 456
4 SASI_Mm01_00072693 predicted 623
5 SASI_Mm01_00072694 predicted 517
6 SASI_Mm01_00072695 predicted 508
7 SASI_Mm01_00072696 predicted 632
8 SASI_Mm01_00072697 predicted 204
9 SASI_Mm01_00072698 predicted 601
10 SASI_Mm01_00072699 predicted 523
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023695
CRYBB1 MISSION shRNA Bacterial Glycerol Stock
crystallin, beta B1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023695.1-614s1c1
Sequence:CCGGCGGCTACCAGTACCCAGGTTACTCGAGTAACCTGGGTACTGGTAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023695.1-477s1c1
Sequence:CCGGCATAAGATCTGCCTGTTCGAACTCGAGTTCGAACAGGCAGATCTTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023695.1-554s1c1
Sequence:CCGGCTGGGTTTATGGCTTCTGTGACTCGAGTCACAGAAGCCATAAACCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023695.1-354s1c1
Sequence:CCGGGCCTTCCGTGGAGAGATGTTTCTCGAGAAACATCTCTCCACGGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023695.1-214s1c1
Sequence:CCGGTGATCGTCTTCGAGCAGGAAACTCGAGTTTCCTGCTCGAAGACGATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023695
CRYBB1 MISSION shRNA shRNA Plasmid DNA
crystallin, beta B1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023695.1-614s1c1
Sequence:CCGGCGGCTACCAGTACCCAGGTTACTCGAGTAACCTGGGTACTGGTAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023695.1-477s1c1
Sequence:CCGGCATAAGATCTGCCTGTTCGAACTCGAGTTCGAACAGGCAGATCTTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023695.1-554s1c1
Sequence:CCGGCTGGGTTTATGGCTTCTGTGACTCGAGTCACAGAAGCCATAAACCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023695.1-354s1c1
Sequence:CCGGGCCTTCCGTGGAGAGATGTTTCTCGAGAAACATCTCTCCACGGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023695.1-214s1c1
Sequence:CCGGTGATCGTCTTCGAGCAGGAAACTCGAGTTTCCTGCTCGAAGACGATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023695
CRYBB1 MISSION shRNA Lentiviral Transduction Particles
crystallin, beta B1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023695.1-614s1c1
Sequence:CCGGCGGCTACCAGTACCCAGGTTACTCGAGTAACCTGGGTACTGGTAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023695.1-477s1c1
Sequence:CCGGCATAAGATCTGCCTGTTCGAACTCGAGTTCGAACAGGCAGATCTTATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023695.1-554s1c1
Sequence:CCGGCTGGGTTTATGGCTTCTGTGACTCGAGTCACAGAAGCCATAAACCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023695.1-354s1c1
Sequence:CCGGGCCTTCCGTGGAGAGATGTTTCTCGAGAAACATCTCTCCACGGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023695.1-214s1c1
Sequence:CCGGTGATCGTCTTCGAGCAGGAAACTCGAGTTTCCTGCTCGAAGACGATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001887
CRYBB1 MISSION shRNA Bacterial Glycerol Stock
crystallin, beta B1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001887.3-638s1c1
Sequence:CCGGAGTGGAACATGGGTTGGCTATCTCGAGATAGCCAACCCATGTTCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001887.3-199s1c1
Sequence:CCGGCGTGCCTATTACCAGCGCCAACTCGAGTTGGCGCTGGTAATAGGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001887.3-674s1c1
Sequence:CCGGCGCGGGTACCAGTACCTCCTACTCGAGTAGGAGGTACTGGTACCCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001887.3-252s1c1
Sequence:CCGGTGGTGGTCTTCGAACTGGAAACTCGAGTTTCCAGTTCGAAGACCACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001887.3-541s1c1
Sequence:CCGGCAACTTCAAGGGCAACACCATCTCGAGATGGTGTTGCCCTTGAAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001887.3-336s21c1
Sequence:CCGGACCGTGTGCGCAGCATCATTGCTCGAGCAATGATGCTGCGCACACGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001887.3-375s21c1
Sequence:CCGGTCGCCTTTGAGCAGTCCAACTCTCGAGAGTTGGACTGCTCAAAGGCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001887.3-703s21c1
Sequence:CCGGTGACTTCCGGCACTGGAATGACTCGAGTCATTCCAGTGCCGGAAGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001887.3-304s21c1
Sequence:CCGGGGAGTGCTCAAATCTGGCAGACTCGAGTCTGCCAGATTTGAGCACTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001887
CRYBB1 MISSION shRNA shRNA Plasmid DNA
crystallin, beta B1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001887.3-638s1c1
Sequence:CCGGAGTGGAACATGGGTTGGCTATCTCGAGATAGCCAACCCATGTTCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001887.3-199s1c1
Sequence:CCGGCGTGCCTATTACCAGCGCCAACTCGAGTTGGCGCTGGTAATAGGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001887.3-674s1c1
Sequence:CCGGCGCGGGTACCAGTACCTCCTACTCGAGTAGGAGGTACTGGTACCCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001887.3-252s1c1
Sequence:CCGGTGGTGGTCTTCGAACTGGAAACTCGAGTTTCCAGTTCGAAGACCACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001887.3-541s1c1
Sequence:CCGGCAACTTCAAGGGCAACACCATCTCGAGATGGTGTTGCCCTTGAAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001887.3-336s21c1
Sequence:CCGGACCGTGTGCGCAGCATCATTGCTCGAGCAATGATGCTGCGCACACGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001887.3-375s21c1
Sequence:CCGGTCGCCTTTGAGCAGTCCAACTCTCGAGAGTTGGACTGCTCAAAGGCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001887.3-703s21c1
Sequence:CCGGTGACTTCCGGCACTGGAATGACTCGAGTCATTCCAGTGCCGGAAGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001887.3-304s21c1
Sequence:CCGGGGAGTGCTCAAATCTGGCAGACTCGAGTCTGCCAGATTTGAGCACTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001887
CRYBB1 MISSION shRNA Lentiviral Transduction Particles
crystallin, beta B1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001887.3-638s1c1
Sequence:CCGGAGTGGAACATGGGTTGGCTATCTCGAGATAGCCAACCCATGTTCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001887.3-199s1c1
Sequence:CCGGCGTGCCTATTACCAGCGCCAACTCGAGTTGGCGCTGGTAATAGGCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001887.3-674s1c1
Sequence:CCGGCGCGGGTACCAGTACCTCCTACTCGAGTAGGAGGTACTGGTACCCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001887.3-252s1c1
Sequence:CCGGTGGTGGTCTTCGAACTGGAAACTCGAGTTTCCAGTTCGAAGACCACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001887.3-541s1c1
Sequence:CCGGCAACTTCAAGGGCAACACCATCTCGAGATGGTGTTGCCCTTGAAGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001887.3-336s21c1
Sequence:CCGGACCGTGTGCGCAGCATCATTGCTCGAGCAATGATGCTGCGCACACGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001887.3-375s21c1
Sequence:CCGGTCGCCTTTGAGCAGTCCAACTCTCGAGAGTTGGACTGCTCAAAGGCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001887.3-703s21c1
Sequence:CCGGTGACTTCCGGCACTGGAATGACTCGAGTCATTCCAGTGCCGGAAGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001887.3-304s21c1
Sequence:CCGGGGAGTGCTCAAATCTGGCAGACTCGAGTCTGCCAGATTTGAGCACTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)