EMAIL THIS PAGE TO A FRIEND

CRYBB2

crystallin, beta B2

49 Gene Product Result for
Synonyms: CCA2 CRYB2 CRYB2A CTRCT3 D22S665
UniProtKB ID: P43320, Q9UCM8
Gene ID:
Human(1415) Summary: Crystallins are separated into two classes: taxon-specific, or enzyme, and ubiquitous. The latter class constitutes the major proteins of vertebrate eye lens and maintains the transparency and refractive index of the lens. Since lens central fiber cells lose their nuclei during development, these crystallins are made and then retained throughout life, making them extremely stable proteins. Mammalian lens crystallins are divided into alpha, beta, and gamma families; beta and gamma crystallins are also considered as a superfamily. Alpha and beta families are further divided into acidic and basic groups. Seven protein regions exist in crystallins: four homologous motifs, a connecting peptide, and N- and C-terminal extensions. Beta-crystallins, the most heterogeneous, differ by the presence of the C-terminal extension (present in the basic group, none in the acidic group). Beta-crystallins form aggregates of different sizes and are able to self-associate to form dimers or to form heterodimers with other beta-crystallins. This gene, a beta basic group member, is part of a gene cluster with beta-A4, beta-B1, and beta-B3. A chain-terminating mutation was found to cause type 2 cerulean cataracts. [provided by RefSeq, Jul 2008]
Mouse(12961) crystallin, beta B2
Rat(25422) crystallin, beta B2
Zebrafish(553182) crystallin, beta B2
chicken(396088) crystallin, beta B2
domestic cat(101083214) crystallin, beta B2
cow(287011) crystallin, beta B2
dog(486326) crystallin, beta B2
sheep(101104345) crystallin, beta B2
Domestic Rabbit(100037715) crystallin, beta B2
domestic guinea pig(100306964) crystallin, beta B2
naked mole-rat(101709109) crystallin, beta B2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000496 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000496 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000496 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007773 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007773 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007773 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU009251 MISSION® esiRNA esiRNA targeting human CRYBB2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000496 Rosetta Predictions human pricing
NM_012937 Rosetta Predictions rat pricing
NM_007773 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000496 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00302657 predicted 183
2 SASI_Hs02_00302658 predicted 723
3 SASI_Hs02_00302659 predicted 125
4 SASI_Hs02_00302660 predicted 604
5 SASI_Hs02_00302661 predicted 722
6 SASI_Hs02_00302662 predicted 596
7 SASI_Hs02_00302663 predicted 727
8 SASI_Hs02_00302664 predicted 689
9 SASI_Hs01_00062775 predicted 416
10 SASI_Hs01_00062776 predicted 356
11 SASI_Hs01_00062777 predicted 400
12 SASI_Hs01_00062778 predicted 359
13 SASI_Hs01_00062779 predicted 435
14 SASI_Hs01_00062780 predicted 437
15 SASI_Hs01_00062781 predicted 395
16 SASI_Hs01_00062782 predicted 346
17 SASI_Hs01_00062783 predicted 412
18 SASI_Hs01_00062784 predicted 357
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012937 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00041407 predicted 385
2 SASI_Rn01_00041408 predicted 332
3 SASI_Rn01_00041409 predicted 410
4 SASI_Rn01_00041410 predicted 413
5 SASI_Rn01_00041411 predicted 382
6 SASI_Rn01_00041413 predicted 212
7 SASI_Rn02_00260502 predicted 313
8 SASI_Rn01_00041414 predicted 491
9 SASI_Rn01_00041415 predicted 377
10 SASI_Rn01_00041416 predicted 255
11 SASI_Rn01_00041412 predicted 418
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007773 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00175325 predicted 329
2 SASI_Mm01_00175326 predicted 407
3 SASI_Mm01_00175327 predicted 330
4 SASI_Mm01_00175328 predicted 326
5 SASI_Mm02_00312417 predicted 360
6 SASI_Mm01_00175329 predicted 485
7 SASI_Mm01_00175330 predicted 408
8 SASI_Mm01_00175331 predicted 372
9 SASI_Mm01_00175332 predicted 401
10 SASI_Mm01_00175333 predicted 292
11 SASI_Mm01_00175334 predicted 322
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000496
CRYBB2 MISSION shRNA Bacterial Glycerol Stock
crystallin, beta B2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000496.2-189s21c1
Sequence:CCGGGAAGGCAGGTTCTGTCCTAGTCTCGAGACTAGGACAGAACCTGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000496.1-328s1c1
Sequence:CCGGGAGCACAAGATCATCCTCTATCTCGAGATAGAGGATGATCTTGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000496.1-363s1c1
Sequence:CCGGCACCGGGAAGAAGATGGAAATCTCGAGATTTCCATCTTCTTCCCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000496.1-379s1c1
Sequence:CCGGGAAATCATAGATGACGATGTACTCGAGTACATCGTCATCTATGATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000496.1-67s1c1
Sequence:CCGGATCATCATCTTTGAGCAGGAACTCGAGTTCCTGCTCAAAGATGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000496.1-570s1c1
Sequence:CCGGCGTGCGCCGTATCCGCGACATCTCGAGATGTCGCGGATACGGCGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000496
CRYBB2 MISSION shRNA shRNA Plasmid DNA
crystallin, beta B2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000496.2-189s21c1
Sequence:CCGGGAAGGCAGGTTCTGTCCTAGTCTCGAGACTAGGACAGAACCTGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000496.1-328s1c1
Sequence:CCGGGAGCACAAGATCATCCTCTATCTCGAGATAGAGGATGATCTTGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000496.1-363s1c1
Sequence:CCGGCACCGGGAAGAAGATGGAAATCTCGAGATTTCCATCTTCTTCCCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000496.1-379s1c1
Sequence:CCGGGAAATCATAGATGACGATGTACTCGAGTACATCGTCATCTATGATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000496.1-67s1c1
Sequence:CCGGATCATCATCTTTGAGCAGGAACTCGAGTTCCTGCTCAAAGATGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000496.1-570s1c1
Sequence:CCGGCGTGCGCCGTATCCGCGACATCTCGAGATGTCGCGGATACGGCGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000496
CRYBB2 MISSION shRNA Lentiviral Transduction Particles
crystallin, beta B2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000496.2-189s21c1
Sequence:CCGGGAAGGCAGGTTCTGTCCTAGTCTCGAGACTAGGACAGAACCTGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000496.1-328s1c1
Sequence:CCGGGAGCACAAGATCATCCTCTATCTCGAGATAGAGGATGATCTTGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000496.1-363s1c1
Sequence:CCGGCACCGGGAAGAAGATGGAAATCTCGAGATTTCCATCTTCTTCCCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000496.1-379s1c1
Sequence:CCGGGAAATCATAGATGACGATGTACTCGAGTACATCGTCATCTATGATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000496.1-67s1c1
Sequence:CCGGATCATCATCTTTGAGCAGGAACTCGAGTTCCTGCTCAAAGATGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000496.1-570s1c1
Sequence:CCGGCGTGCGCCGTATCCGCGACATCTCGAGATGTCGCGGATACGGCGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007773
CRYBB2 MISSION shRNA Bacterial Glycerol Stock
crystallin, beta B2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000418882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007773.3-254s21c1
Sequence:CCGGAGTACCCACGTTGGGACTCCTCTCGAGAGGAGTCCCAACGTGGGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007773.3-388s21c1
Sequence:CCGGGAGATTGTAGACGACGATGTGCTCGAGCACATCGTCGTCTACAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007773.1-337s1c1
Sequence:CCGGGAGCACAAGATCATCTTATATCTCGAGATATAAGATGATCTTGTGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007773.1-138s1c1
Sequence:CCGGCAACCTGAAGGAGACTGGTATCTCGAGATACCAGTCTCCTTCAGGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007773.1-365s1c1
Sequence:CCGGCCAACTTTACTGGCAAGAAGACTCGAGTCTTCTTGCCAGTAAAGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007773.1-316s1c1
Sequence:CCGGCCCATCAAAGTGGACAGCCAACTCGAGTTGGCTGTCCACTTTGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007773.1-227s1c1
Sequence:CCGGGCGAGCAGTTTGTGTTTGAAACTCGAGTTTCAAACACAAACTGCTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007773
CRYBB2 MISSION shRNA shRNA Plasmid DNA
crystallin, beta B2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000418882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007773.3-254s21c1
Sequence:CCGGAGTACCCACGTTGGGACTCCTCTCGAGAGGAGTCCCAACGTGGGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007773.3-388s21c1
Sequence:CCGGGAGATTGTAGACGACGATGTGCTCGAGCACATCGTCGTCTACAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007773.1-337s1c1
Sequence:CCGGGAGCACAAGATCATCTTATATCTCGAGATATAAGATGATCTTGTGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007773.1-138s1c1
Sequence:CCGGCAACCTGAAGGAGACTGGTATCTCGAGATACCAGTCTCCTTCAGGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007773.1-365s1c1
Sequence:CCGGCCAACTTTACTGGCAAGAAGACTCGAGTCTTCTTGCCAGTAAAGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007773.1-316s1c1
Sequence:CCGGCCCATCAAAGTGGACAGCCAACTCGAGTTGGCTGTCCACTTTGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007773.1-227s1c1
Sequence:CCGGGCGAGCAGTTTGTGTTTGAAACTCGAGTTTCAAACACAAACTGCTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007773
CRYBB2 MISSION shRNA Lentiviral Transduction Particles
crystallin, beta B2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000418882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007773.3-254s21c1
Sequence:CCGGAGTACCCACGTTGGGACTCCTCTCGAGAGGAGTCCCAACGTGGGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007773.3-388s21c1
Sequence:CCGGGAGATTGTAGACGACGATGTGCTCGAGCACATCGTCGTCTACAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007773.1-337s1c1
Sequence:CCGGGAGCACAAGATCATCTTATATCTCGAGATATAAGATGATCTTGTGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007773.1-138s1c1
Sequence:CCGGCAACCTGAAGGAGACTGGTATCTCGAGATACCAGTCTCCTTCAGGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007773.1-365s1c1
Sequence:CCGGCCAACTTTACTGGCAAGAAGACTCGAGTCTTCTTGCCAGTAAAGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007773.1-316s1c1
Sequence:CCGGCCCATCAAAGTGGACAGCCAACTCGAGTTGGCTGTCCACTTTGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007773.1-227s1c1
Sequence:CCGGGCGAGCAGTTTGTGTTTGAAACTCGAGTTTCAAACACAAACTGCTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks