EMAIL THIS PAGE TO A FRIEND

CRYBB3

crystallin, beta B3

54 Gene Product Result for
Synonyms: CATCN2 CRYB3 CTRCT22
UniProtKB ID: P26998, Q3B7S9, Q3T1B7, Q6ISK6, Q92965, Q9UH09
Gene ID:
Human(1417) Summary: Crystallins are separated into two classes: taxon-specific, or enzyme, and ubiquitous. The latter class constitutes the major proteins of vertebrate eye lens and maintains the transparency and refractive index of the lens. Since lens central fiber cells lose their nuclei during development, these crystallins are made and then retained throughout life, making them extremely stable proteins. Mammalian lens crystallins are divided into alpha, beta, and gamma families; beta and gamma crystallins are also considered as a superfamily. Alpha and beta families are further divided into acidic and basic groups. Seven protein regions exist in crystallins: four homologous motifs, a connecting peptide, and N- and C-terminal extensions. Beta-crystallins, the most heterogeneous, differ by the presence of the C-terminal extension (present in the basic group, none in the acidic group). Beta-crystallins form aggregates of different sizes and are able to self-associate to form dimers or to form heterodimers with other beta-crystallins. This gene, a beta basic group member, is part of a gene cluster with beta-A4, beta-B1, and beta-B2. Mutations in this gene result in cataract congenital nuclear autosomal recessive type 2. [provided by RefSeq, Feb 2013]
Mouse(12962) crystallin, beta B3
Rat(64349) crystallin, beta B3
Zebrafish(553184) crystallin, beta B3
chicken(396108) crystallin, beta B3
domestic cat(101082953) crystallin, beta B3
cow(282206) crystallin, beta B3
dog(790954) crystallin, beta B3
naked mole-rat(101709702) crystallin, beta B3
domestic guinea pig(100306963) crystallin, beta B3
sheep(780513) crystallin, beta B3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004076 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004076 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004076 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021352 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021352 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021352 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU091231 MISSION® esiRNA esiRNA targeting mouse Crybb3 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004076 Rosetta Predictions human pricing
NM_031690 Rosetta Predictions rat pricing
NM_021352 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004076 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081114 predicted 590
2 SASI_Hs01_00081115 predicted 592
3 SASI_Hs01_00081116 predicted 350
4 SASI_Hs01_00081117 predicted 437
5 SASI_Hs01_00081118 predicted 416
6 SASI_Hs01_00081119 predicted 453
7 SASI_Hs01_00081121 predicted 227
8 SASI_Hs02_00336870 predicted 514
9 SASI_Hs01_00081122 predicted 407
10 SASI_Hs01_00081123 predicted 345
11 SASI_Hs01_00081120 predicted 441
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031690 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00086505 predicted 325
2 SASI_Rn02_00265033 predicted 405
3 SASI_Rn01_00086507 predicted 477
4 SASI_Rn01_00086509 predicted 444
5 SASI_Rn01_00086510 predicted 505
6 SASI_Rn01_00086511 predicted 418
7 SASI_Rn01_00086512 predicted 420
8 SASI_Rn01_00086513 predicted 413
9 SASI_Rn01_00086514 predicted 444
10 SASI_Rn02_00265034 predicted 198
11 SASI_Rn01_00086506 predicted 318
12 SASI_Rn01_00086508 predicted 305
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021352 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00061058 predicted 478
2 SASI_Mm01_00061059 predicted 396
3 SASI_Mm01_00061060 predicted 491
4 SASI_Mm01_00061061 predicted 489
5 SASI_Mm01_00061063 predicted 504
6 SASI_Mm01_00061064 predicted 430
7 SASI_Mm01_00061065 predicted 244
8 SASI_Mm01_00061066 predicted 558
9 SASI_Mm01_00061067 predicted 496
10 SASI_Mm02_00325935 predicted 225
11 SASI_Mm01_00061062 predicted 598
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004076
CRYBB3 MISSION shRNA Bacterial Glycerol Stock
crystallin, beta B3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004076.3-301s1c1
Sequence:CCGGGAGCAGTTTGTTCTGGAGAAGCTCGAGCTTCTCCAGAACAAACTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004076.3-150s1c1
Sequence:CCGGGATCTTGTACGAACTAGAGAACTCGAGTTCTCTAGTTCGTACAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004076.3-153s1c1
Sequence:CCGGCTTGTACGAACTAGAGAACTTCTCGAGAAGTTCTCTAGTTCGTACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004076.3-456s1c1
Sequence:CCGGGATGGAGATAGTGGATGATGACTCGAGTCATCATCCACTATCTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004076.3-137s1c1
Sequence:CCGGGCAGCTACAAGGTGATCTTGTCTCGAGACAAGATCACCTTGTAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000447004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004076.3-540s21c1
Sequence:CCGGGACGTGGGTTGGCTATGAGTTCTCGAGAACTCATAGCCAACCCACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004076.3-602s21c1
Sequence:CCGGAGTACCGCCACTGGAATGAGTCTCGAGACTCATTCCAGTGGCGGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004076
CRYBB3 MISSION shRNA shRNA Plasmid DNA
crystallin, beta B3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004076.3-301s1c1
Sequence:CCGGGAGCAGTTTGTTCTGGAGAAGCTCGAGCTTCTCCAGAACAAACTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004076.3-150s1c1
Sequence:CCGGGATCTTGTACGAACTAGAGAACTCGAGTTCTCTAGTTCGTACAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004076.3-153s1c1
Sequence:CCGGCTTGTACGAACTAGAGAACTTCTCGAGAAGTTCTCTAGTTCGTACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004076.3-456s1c1
Sequence:CCGGGATGGAGATAGTGGATGATGACTCGAGTCATCATCCACTATCTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004076.3-137s1c1
Sequence:CCGGGCAGCTACAAGGTGATCTTGTCTCGAGACAAGATCACCTTGTAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000447004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004076.3-540s21c1
Sequence:CCGGGACGTGGGTTGGCTATGAGTTCTCGAGAACTCATAGCCAACCCACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004076.3-602s21c1
Sequence:CCGGAGTACCGCCACTGGAATGAGTCTCGAGACTCATTCCAGTGGCGGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004076
CRYBB3 MISSION shRNA Lentiviral Transduction Particles
crystallin, beta B3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004076.3-301s1c1
Sequence:CCGGGAGCAGTTTGTTCTGGAGAAGCTCGAGCTTCTCCAGAACAAACTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004076.3-150s1c1
Sequence:CCGGGATCTTGTACGAACTAGAGAACTCGAGTTCTCTAGTTCGTACAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004076.3-153s1c1
Sequence:CCGGCTTGTACGAACTAGAGAACTTCTCGAGAAGTTCTCTAGTTCGTACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004076.3-456s1c1
Sequence:CCGGGATGGAGATAGTGGATGATGACTCGAGTCATCATCCACTATCTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004076.3-137s1c1
Sequence:CCGGGCAGCTACAAGGTGATCTTGTCTCGAGACAAGATCACCTTGTAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000447004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004076.3-540s21c1
Sequence:CCGGGACGTGGGTTGGCTATGAGTTCTCGAGAACTCATAGCCAACCCACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004076.3-602s21c1
Sequence:CCGGAGTACCGCCACTGGAATGAGTCTCGAGACTCATTCCAGTGGCGGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021352
CRYBB3 MISSION shRNA Bacterial Glycerol Stock
crystallin, beta B3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098015    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021352.2-781s1c1
Sequence:CCGGCCTTCCTGAACCTGCTCAATACTCGAGTATTGAGCAGGTTCAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021352.2-495s1c1
Sequence:CCGGCGCAAGATGGAGATCGTAGATCTCGAGATCTACGATCTCCATCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021352.2-194s1c1
Sequence:CCGGGACGGTGTACGAGTTAGAGAACTCGAGTTCTCTAACTCGTACACCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021352.2-707s1c1
Sequence:CCGGCCGCGACCAGAAGTGGCACAACTCGAGTTGTGCCACTTCTGGTCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021352.2-403s1c1
Sequence:CCGGGACGTAGTGACATTCTCCTGTCTCGAGACAGGAGAATGTCACTACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021352
CRYBB3 MISSION shRNA shRNA Plasmid DNA
crystallin, beta B3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098015    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021352.2-781s1c1
Sequence:CCGGCCTTCCTGAACCTGCTCAATACTCGAGTATTGAGCAGGTTCAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021352.2-495s1c1
Sequence:CCGGCGCAAGATGGAGATCGTAGATCTCGAGATCTACGATCTCCATCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021352.2-194s1c1
Sequence:CCGGGACGGTGTACGAGTTAGAGAACTCGAGTTCTCTAACTCGTACACCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021352.2-707s1c1
Sequence:CCGGCCGCGACCAGAAGTGGCACAACTCGAGTTGTGCCACTTCTGGTCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021352.2-403s1c1
Sequence:CCGGGACGTAGTGACATTCTCCTGTCTCGAGACAGGAGAATGTCACTACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021352
CRYBB3 MISSION shRNA Lentiviral Transduction Particles
crystallin, beta B3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098015    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021352.2-781s1c1
Sequence:CCGGCCTTCCTGAACCTGCTCAATACTCGAGTATTGAGCAGGTTCAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021352.2-495s1c1
Sequence:CCGGCGCAAGATGGAGATCGTAGATCTCGAGATCTACGATCTCCATCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021352.2-194s1c1
Sequence:CCGGGACGGTGTACGAGTTAGAGAACTCGAGTTCTCTAACTCGTACACCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021352.2-707s1c1
Sequence:CCGGCCGCGACCAGAAGTGGCACAACTCGAGTTGTGCCACTTCTGGTCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021352.2-403s1c1
Sequence:CCGGGACGTAGTGACATTCTCCTGTCTCGAGACAGGAGAATGTCACTACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks