EMAIL THIS PAGE TO A FRIEND

CRYBG3

beta-gamma crystallin domain containing 3

81 Gene Product Result for
Synonyms: DKFZp667G2110
Gene ID:
Mouse(224273) beta-gamma crystallin domain containing 3
Rat(288204) beta-gamma crystallin domain containing 3
chicken(418437) beta-gamma crystallin domain containing 3
Horse(100072549) beta-gamma crystallin domain containing 3
dog(478532) uncharacterized LOC478532
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA054441 Anti-CRYBG3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153605 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153605 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153605 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_174848 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_174848 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_174848 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153605 Rosetta Predictions human pricing
XM_001057435 Rosetta Predictions rat pricing
XM_213639 Rosetta Predictions rat pricing
NM_174848 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153605 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00198877 predicted 2168
2 SASI_Hs01_00198878 predicted 1645
3 SASI_Hs01_00198879 predicted 2883
4 SASI_Hs01_00198880 predicted 2349
5 SASI_Hs01_00198882 predicted 381
6 SASI_Hs01_00198883 predicted 2178
7 SASI_Hs01_00198884 predicted 3013
8 SASI_Hs02_00367333 predicted 2632
9 SASI_Hs02_00367334 predicted 509
10 SASI_Hs02_00367335 predicted 827
11 SASI_Hs01_00198876 predicted 3133
12 SASI_Hs01_00198881 predicted 3066
13 SASI_Hs01_00198885 predicted 3181
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057435 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00286339 predicted 5974
2 SASI_Rn02_00286340 predicted 3621
3 SASI_Rn02_00286341 predicted 964
4 SASI_Rn02_00286342 predicted 2255
5 SASI_Rn02_00286343 predicted 4945
6 SASI_Rn02_00286344 predicted 980
7 SASI_Rn02_00286345 predicted 7897
8 SASI_Rn02_00286346 predicted 2065
9 SASI_Rn02_00286347 predicted 6524
10 SASI_Rn02_00286348 predicted 5179
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_213639 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00374786 predicted 5979
2 SASI_Rn02_00374787 predicted 3619
3 SASI_Rn02_00374788 predicted 961
4 SASI_Rn02_00374789 predicted 2255
5 SASI_Rn02_00374790 predicted 4949
6 SASI_Rn02_00374791 predicted 986
7 SASI_Rn02_00374792 predicted 7896
8 SASI_Rn02_00374793 predicted 2066
9 SASI_Rn02_00374794 predicted 6520
10 SASI_Rn02_00374795 predicted 5177
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174848 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00183696 predicted 2225
2 SASI_Mm01_00183697 predicted 3474
3 SASI_Mm01_00183698 predicted 2456
4 SASI_Mm01_00183699 predicted 2746
5 SASI_Mm01_00183700 predicted 3186
6 SASI_Mm01_00183701 predicted 1873
7 SASI_Mm01_00183703 predicted 1503
8 SASI_Mm01_00183704 predicted 1462
9 SASI_Mm01_00183705 predicted 3195
10 SASI_Mm02_00345495 predicted 3225
11 SASI_Mm01_00183702 predicted 2942
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153605
VALIDATED
CRYBG3 MISSION shRNA Bacterial Glycerol Stock
beta-gamma crystallin domain containing 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_153605.2-604s21c1
Sequence:CCGGGTCAGTGTCAGAACGTTTAAACTCGAGTTTAAACGTTCTGACACTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153605.2-2189s21c1
Sequence:CCGGCTGGAACCACTTGGGATAAATCTCGAGATTTATCCCAAGTGGTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153605.2-1931s21c1
Sequence:CCGGGAATCTTCTGTCACACTATTTCTCGAGAAATAGTGTGACAGAAGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_153605.2-1512s21c1
Sequence:CCGGGGCTTGCCTACCCAGATATTACTCGAGTAATATCTGGGTAGGCAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_153605.2-1904s21c1
Sequence:CCGGTTCCGGTACTTACAAGCTAATCTCGAGATTAGCTTGTAAGTACCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153605
VALIDATED
CRYBG3 MISSION shRNA shRNA Plasmid DNA
beta-gamma crystallin domain containing 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_153605.2-604s21c1
Sequence:CCGGGTCAGTGTCAGAACGTTTAAACTCGAGTTTAAACGTTCTGACACTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153605.2-2189s21c1
Sequence:CCGGCTGGAACCACTTGGGATAAATCTCGAGATTTATCCCAAGTGGTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153605.2-1931s21c1
Sequence:CCGGGAATCTTCTGTCACACTATTTCTCGAGAAATAGTGTGACAGAAGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_153605.2-1512s21c1
Sequence:CCGGGGCTTGCCTACCCAGATATTACTCGAGTAATATCTGGGTAGGCAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_153605.2-1904s21c1
Sequence:CCGGTTCCGGTACTTACAAGCTAATCTCGAGATTAGCTTGTAAGTACCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153605
VALIDATED
CRYBG3 MISSION shRNA Lentiviral Transduction Particles
beta-gamma crystallin domain containing 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_153605.2-604s21c1
Sequence:CCGGGTCAGTGTCAGAACGTTTAAACTCGAGTTTAAACGTTCTGACACTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153605.2-2189s21c1
Sequence:CCGGCTGGAACCACTTGGGATAAATCTCGAGATTTATCCCAAGTGGTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153605.2-1931s21c1
Sequence:CCGGGAATCTTCTGTCACACTATTTCTCGAGAAATAGTGTGACAGAAGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_153605.2-1512s21c1
Sequence:CCGGGGCTTGCCTACCCAGATATTACTCGAGTAATATCTGGGTAGGCAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_153605.2-1904s21c1
Sequence:CCGGTTCCGGTACTTACAAGCTAATCTCGAGATTAGCTTGTAAGTACCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174848
VALIDATED
CRYBG3 MISSION shRNA Bacterial Glycerol Stock
beta-gamma crystallin domain containing 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000258143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_174848.2-603s21c1
Sequence:CCGGGGCTATGAGTCGCCTACATTACTCGAGTAATGTAGGCGACTCATAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_174848.2-2775s21c1
Sequence:CCGGTTGGAACCACTCGGGATAAATCTCGAGATTTATCCCGAGTGGTTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215438    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174848.2-3198s1c1
Sequence:CCGGGCTTATGAAGGTTCCAATTTCCTCGAGGAAATTGGAACCTTCATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215437    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174848.2-2234s1c1
Sequence:CCGGGAACTTAAAGGTTATCCTTTACTCGAGTAAAGGATAACCTTTAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250996    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174848.2-4380s21c1
Sequence:CCGGGCACCCAGTGTTGAGTATTAACTCGAGTTAATACTCAACACTGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_174848.2-706s21c1
Sequence:CCGGTGTCTGTCCCTGTAGTATATGCTCGAGCATATACTACAGGGACAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_174848.2-1582s21c1
Sequence:CCGGAGGAACCAGTGTCCAAGTATTCTCGAGAATACTTGGACACTGGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179955    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_174848.2-4634s1c1
Sequence:CCGGCCCTCCTAAGATGGACTTAATCTCGAGATTAAGTCCATCTTAGGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179662    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_174848.2-4316s1c1
Sequence:CCGGGCGTGACCAATCTTTACTGTTCTCGAGAACAGTAAAGATTGGTCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174848
VALIDATED
CRYBG3 MISSION shRNA shRNA Plasmid DNA
beta-gamma crystallin domain containing 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000258143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_174848.2-603s21c1
Sequence:CCGGGGCTATGAGTCGCCTACATTACTCGAGTAATGTAGGCGACTCATAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_174848.2-2775s21c1
Sequence:CCGGTTGGAACCACTCGGGATAAATCTCGAGATTTATCCCGAGTGGTTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215438    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174848.2-3198s1c1
Sequence:CCGGGCTTATGAAGGTTCCAATTTCCTCGAGGAAATTGGAACCTTCATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215437    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174848.2-2234s1c1
Sequence:CCGGGAACTTAAAGGTTATCCTTTACTCGAGTAAAGGATAACCTTTAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250996    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174848.2-4380s21c1
Sequence:CCGGGCACCCAGTGTTGAGTATTAACTCGAGTTAATACTCAACACTGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_174848.2-706s21c1
Sequence:CCGGTGTCTGTCCCTGTAGTATATGCTCGAGCATATACTACAGGGACAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_174848.2-1582s21c1
Sequence:CCGGAGGAACCAGTGTCCAAGTATTCTCGAGAATACTTGGACACTGGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179955    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_174848.2-4634s1c1
Sequence:CCGGCCCTCCTAAGATGGACTTAATCTCGAGATTAAGTCCATCTTAGGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179662    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_174848.2-4316s1c1
Sequence:CCGGGCGTGACCAATCTTTACTGTTCTCGAGAACAGTAAAGATTGGTCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174848
VALIDATED
CRYBG3 MISSION shRNA Lentiviral Transduction Particles
beta-gamma crystallin domain containing 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000258143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_174848.2-603s21c1
Sequence:CCGGGGCTATGAGTCGCCTACATTACTCGAGTAATGTAGGCGACTCATAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_174848.2-2775s21c1
Sequence:CCGGTTGGAACCACTCGGGATAAATCTCGAGATTTATCCCGAGTGGTTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215438    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174848.2-3198s1c1
Sequence:CCGGGCTTATGAAGGTTCCAATTTCCTCGAGGAAATTGGAACCTTCATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215437    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174848.2-2234s1c1
Sequence:CCGGGAACTTAAAGGTTATCCTTTACTCGAGTAAAGGATAACCTTTAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250996    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174848.2-4380s21c1
Sequence:CCGGGCACCCAGTGTTGAGTATTAACTCGAGTTAATACTCAACACTGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_174848.2-706s21c1
Sequence:CCGGTGTCTGTCCCTGTAGTATATGCTCGAGCATATACTACAGGGACAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_174848.2-1582s21c1
Sequence:CCGGAGGAACCAGTGTCCAAGTATTCTCGAGAATACTTGGACACTGGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179955    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_174848.2-4634s1c1
Sequence:CCGGCCCTCCTAAGATGGACTTAATCTCGAGATTAAGTCCATCTTAGGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179662    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_174848.2-4316s1c1
Sequence:CCGGGCGTGACCAATCTTTACTGTTCTCGAGAACAGTAAAGATTGGTCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks