EMAIL THIS PAGE TO A FRIEND

CRYGA

crystallin, gamma A

41 Gene Product Result for
Synonyms: CRY-g-A CRYG1 CRYG5
UniProtKB ID: P11844, Q53ST5
Gene ID:
Human(1418) Summary: Crystallins are separated into two classes: taxon-specific, or enzyme, and ubiquitous. The latter class constitutes the major proteins of vertebrate eye lens and maintains the transparency and refractive index of the lens. Since lens central fiber cells lose their nuclei during development, these crystallins are made and then retained throughout life, making them extremely stable proteins. Mammalian lens crystallins are divided into alpha, beta, and gamma families; beta and gamma crystallins are also considered as a superfamily. Alpha and beta families are further divided into acidic and basic groups. Seven protein regions exist in crystallins: four homologous motifs, a connecting peptide, and N- and C-terminal extensions. Gamma-crystallins are a homogeneous group of highly symmetrical, monomeric proteins typically lacking connecting peptides and terminal extensions. They are differentially regulated after early development. Four gamma-crystallin genes (gamma-A through gamma-D) and three pseudogenes (gamma-E, gamma-F, gamma-G) are tandemly organized in a genomic segment as a gene cluster. Whether due to aging or mutations in specific genes, gamma-crystallins have been involved in cataract formation. [provided by RefSeq, Jul 2008]
Mouse(12964) crystallin, gamma A
Rat(684028) crystallin, gamma A
domestic guinea pig(100337642) crystallin, gamma A
sheep(101120055) crystallin, gamma A
cow(538688) crystallin, gamma A
cow(100335856) crystallin, gamma A
dog(488498) crystallin, gamma A
domestic cat(101093630) crystallin, gamma A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302718 ANTI-CRYGA (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007774 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007774 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007774 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014617 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014617 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014617 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014617 Rosetta Predictions human pricing
NM_001080936 Rosetta Predictions rat pricing
NM_007774 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014617 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00345909 predicted 361
2 SASI_Hs01_00080685 predicted 235
3 SASI_Hs01_00080686 predicted 235
4 SASI_Hs01_00080688 predicted 303
5 SASI_Hs01_00080689 predicted 246
6 SASI_Hs01_00080690 predicted 279
7 SASI_Hs02_00345910 predicted 230
8 SASI_Hs01_00080692 predicted 270
9 SASI_Hs01_00080693 predicted 250
10 SASI_Hs02_00345911 predicted 312
11 SASI_Hs01_00080687 predicted 329
12 SASI_Hs01_00080691 predicted 204
13 SASI_Hs01_00080694 predicted 305
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080936 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00208549 predicted 302
2 SASI_Rn02_00208550 predicted 374
3 SASI_Rn02_00208551 predicted 348
4 SASI_Rn02_00208552 predicted 258
5 SASI_Rn02_00208553 predicted 385
6 SASI_Rn02_00208554 predicted 379
7 SASI_Rn02_00208555 predicted 365
8 SASI_Rn02_00208556 predicted 370
9 SASI_Rn02_00208557 predicted 278
10 SASI_Rn02_00208558 predicted 294
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007774 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00089457 predicted 254
2 SASI_Mm01_00089458 predicted 282
3 SASI_Mm01_00089459 predicted 249
4 SASI_Mm01_00089460 predicted 282
5 SASI_Mm01_00089461 predicted 364
6 SASI_Mm01_00089462 predicted 274
7 SASI_Mm01_00089463 predicted 260
8 SASI_Mm02_00312418 predicted 290
9 SASI_Mm01_00089464 predicted 334
10 SASI_Mm01_00089465 predicted 363
11 SASI_Mm01_00089456 predicted 280
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007774
CRYGA MISSION shRNA Bacterial Glycerol Stock
crystallin, gamma A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007774.3-284s1c1
Sequence:CCGGCTCTCACAGGATAAGGCTTTACTCGAGTAAAGCCTTATCCTGTGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007774.3-467s1c1
Sequence:CCGGGCCTGGAGACTACAGGCGCTACTCGAGTAGCGCCTGTAGTCTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007774.3-347s1c1
Sequence:CCGGCGACTGTTCCTGCATCCACGACTCGAGTCGTGGATGCAGGAACAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007774.3-262s1c1
Sequence:CCGGGCCGTTCCATTCCATACACCACTCGAGTGGTGTATGGAATGGAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007774.3-377s1c1
Sequence:CCGGCCTCCATGAGATCTACTCCATCTCGAGATGGAGTAGATCTCATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007774
CRYGA MISSION shRNA shRNA Plasmid DNA
crystallin, gamma A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007774.3-284s1c1
Sequence:CCGGCTCTCACAGGATAAGGCTTTACTCGAGTAAAGCCTTATCCTGTGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007774.3-467s1c1
Sequence:CCGGGCCTGGAGACTACAGGCGCTACTCGAGTAGCGCCTGTAGTCTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007774.3-347s1c1
Sequence:CCGGCGACTGTTCCTGCATCCACGACTCGAGTCGTGGATGCAGGAACAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007774.3-262s1c1
Sequence:CCGGGCCGTTCCATTCCATACACCACTCGAGTGGTGTATGGAATGGAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007774.3-377s1c1
Sequence:CCGGCCTCCATGAGATCTACTCCATCTCGAGATGGAGTAGATCTCATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007774
CRYGA MISSION shRNA Lentiviral Transduction Particles
crystallin, gamma A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007774.3-284s1c1
Sequence:CCGGCTCTCACAGGATAAGGCTTTACTCGAGTAAAGCCTTATCCTGTGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007774.3-467s1c1
Sequence:CCGGGCCTGGAGACTACAGGCGCTACTCGAGTAGCGCCTGTAGTCTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007774.3-347s1c1
Sequence:CCGGCGACTGTTCCTGCATCCACGACTCGAGTCGTGGATGCAGGAACAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007774.3-262s1c1
Sequence:CCGGGCCGTTCCATTCCATACACCACTCGAGTGGTGTATGGAATGGAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007774.3-377s1c1
Sequence:CCGGCCTCCATGAGATCTACTCCATCTCGAGATGGAGTAGATCTCATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014617
CRYGA MISSION shRNA Bacterial Glycerol Stock
crystallin, gamma A
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163705    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014617.2-466s1c1
Sequence:CCGGGAGATCTATTCCCTCCACGTACTCGAGTACGTGGAGGGAATAGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162753    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014617.2-409s1c1
Sequence:CCGGCTTATGTCTGAGCTCACTGATCTCGAGATCAGTGAGCTCAGACATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160722    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014617.2-341s1c1
Sequence:CCGGCCTGCCGTATAATTCCTCATACTCGAGTATGAGGAATTATACGGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162841    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014617.2-151s1c1
Sequence:CCGGCGCTGCTACAATTGCATCAGTCTCGAGACTGATGCAATTGTAGCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163172    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014617.2-240s1c1
Sequence:CCGGGCTCTATGAGCGTCCCAATTACTCGAGTAATTGGGACGCTCATAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014617
CRYGA MISSION shRNA shRNA Plasmid DNA
crystallin, gamma A
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163705    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014617.2-466s1c1
Sequence:CCGGGAGATCTATTCCCTCCACGTACTCGAGTACGTGGAGGGAATAGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162753    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014617.2-409s1c1
Sequence:CCGGCTTATGTCTGAGCTCACTGATCTCGAGATCAGTGAGCTCAGACATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160722    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014617.2-341s1c1
Sequence:CCGGCCTGCCGTATAATTCCTCATACTCGAGTATGAGGAATTATACGGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162841    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014617.2-151s1c1
Sequence:CCGGCGCTGCTACAATTGCATCAGTCTCGAGACTGATGCAATTGTAGCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163172    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014617.2-240s1c1
Sequence:CCGGGCTCTATGAGCGTCCCAATTACTCGAGTAATTGGGACGCTCATAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014617
CRYGA MISSION shRNA Lentiviral Transduction Particles
crystallin, gamma A
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163705    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014617.2-466s1c1
Sequence:CCGGGAGATCTATTCCCTCCACGTACTCGAGTACGTGGAGGGAATAGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162753    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014617.2-409s1c1
Sequence:CCGGCTTATGTCTGAGCTCACTGATCTCGAGATCAGTGAGCTCAGACATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160722    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014617.2-341s1c1
Sequence:CCGGCCTGCCGTATAATTCCTCATACTCGAGTATGAGGAATTATACGGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162841    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014617.2-151s1c1
Sequence:CCGGCGCTGCTACAATTGCATCAGTCTCGAGACTGATGCAATTGTAGCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163172    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014617.2-240s1c1
Sequence:CCGGGCTCTATGAGCGTCCCAATTACTCGAGTAATTGGGACGCTCATAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks