EMAIL THIS PAGE TO A FRIEND

CRYGB

crystallin, gamma B

44 Gene Product Result for
Synonyms: CRYG2 CTRCT39
UniProtKB ID: P07316, Q17RB5, Q53ST2
Gene ID:
Human(1419) Summary: Crystallins are separated into two classes: taxon-specific, or enzyme, and ubiquitous. The latter class constitutes the major proteins of vertebrate eye lens and maintains the transparency and refractive index of the lens. Since lens central fiber cells lose their nuclei during development, these crystallins are made and then retained throughout life, making them extremely stable proteins. Mammalian lens crystallins are divided into alpha, beta, and gamma families; beta and gamma crystallins are also considered as a superfamily. Alpha and beta families are further divided into acidic and basic groups. Seven protein regions exist in crystallins: four homologous motifs, a connecting peptide, and N- and C-terminal extensions. Gamma-crystallins are a homogeneous group of highly symmetrical, monomeric proteins typically lacking connecting peptides and terminal extensions. They are differentially regulated after early development. Four gamma-crystallin genes (gamma-A through gamma-D) and three pseudogenes (gamma-E, gamma-F, gamma-G) are tandemly organized in a genomic segment as a gene cluster. Whether due to aging or mutations in specific genes, gamma-crystallins have been involved in cataract formation. [provided by RefSeq, Jul 2008]
Mouse(12965) crystallin, gamma B
Rat(301468) crystallin, gamma B
domestic cat(101093383) crystallin, gamma B
cow(281720) crystallin, gamma B
dog(488497) crystallin, gamma B
sheep(101119795) crystallin, gamma B
domestic guinea pig(100307057) crystallin, gamma B
naked mole-rat(101707479) crystallin, gamma B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144761 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144761 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144761 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005210 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005210 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005210 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU164531 MISSION® esiRNA esiRNA targeting mouse Crygb mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005210 Rosetta Predictions human pricing
NM_001109875 Rosetta Predictions rat pricing
NM_144761 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005210 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00063796 predicted 290
2 SASI_Hs01_00063798 predicted 274
3 SASI_Hs01_00063799 predicted 286
4 SASI_Hs01_00063800 predicted 280
5 SASI_Hs01_00063801 predicted 385
6 SASI_Hs02_00339183 predicted 351
7 SASI_Hs01_00063802 predicted 302
8 SASI_Hs01_00063803 predicted 280
9 SASI_Hs01_00063804 predicted 279
10 SASI_Hs02_00339184 predicted 289
11 SASI_Hs01_00063797 predicted 359
12 SASI_Hs01_00063805 predicted 304
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109875 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00250652 predicted 285
2 SASI_Rn02_00250653 predicted 283
3 SASI_Rn02_00250654 predicted 286
4 SASI_Rn02_00250655 predicted 330
5 SASI_Rn02_00250656 predicted 390
6 SASI_Rn02_00250657 predicted 317
7 SASI_Rn02_00250658 predicted 393
8 SASI_Rn02_00250659 predicted 349
9 SASI_Rn02_00250660 predicted 300
10 SASI_Rn02_00250661 predicted 392
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144761 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00155273 predicted 311
2 SASI_Mm01_00155274 predicted 268
3 SASI_Mm01_00155275 predicted 325
4 SASI_Mm01_00155276 predicted 301
5 SASI_Mm01_00155277 predicted 294
6 SASI_Mm02_00340119 predicted 274
7 SASI_Mm01_00155278 predicted 369
8 SASI_Mm01_00155279 predicted 261
9 SASI_Mm01_00155280 predicted 259
10 SASI_Mm01_00155281 predicted 329
11 SASI_Mm01_00155282 predicted 301
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144761
CRYGB MISSION shRNA Bacterial Glycerol Stock
crystallin, gamma B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144761.1-342s1c1
Sequence:CCGGTCTCTCTCTTCAGGATCGCTTCTCGAGAAGCGATCCTGAAGAGAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144761.1-331s1c1
Sequence:CCGGACAGACGATTGTCTCTCTCTTCTCGAGAAGAGAGAGACAATCGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144761.1-230s1c1
Sequence:CCGGGCGACTCCATTCGTTCCTGCTCTCGAGAGCAGGAACGAATGGAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144761.1-369s1c1
Sequence:CCGGCAGTGAAATCCACTCCCTCAACTCGAGTTGAGGGAGTGGATTTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144761.1-270s1c1
Sequence:CCGGTGGCACTTACAGAATGAGGATCTCGAGATCCTCATTCTGTAAGTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144761
CRYGB MISSION shRNA shRNA Plasmid DNA
crystallin, gamma B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144761.1-342s1c1
Sequence:CCGGTCTCTCTCTTCAGGATCGCTTCTCGAGAAGCGATCCTGAAGAGAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144761.1-331s1c1
Sequence:CCGGACAGACGATTGTCTCTCTCTTCTCGAGAAGAGAGAGACAATCGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144761.1-230s1c1
Sequence:CCGGGCGACTCCATTCGTTCCTGCTCTCGAGAGCAGGAACGAATGGAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144761.1-369s1c1
Sequence:CCGGCAGTGAAATCCACTCCCTCAACTCGAGTTGAGGGAGTGGATTTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144761.1-270s1c1
Sequence:CCGGTGGCACTTACAGAATGAGGATCTCGAGATCCTCATTCTGTAAGTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144761
CRYGB MISSION shRNA Lentiviral Transduction Particles
crystallin, gamma B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144761.1-342s1c1
Sequence:CCGGTCTCTCTCTTCAGGATCGCTTCTCGAGAAGCGATCCTGAAGAGAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144761.1-331s1c1
Sequence:CCGGACAGACGATTGTCTCTCTCTTCTCGAGAAGAGAGAGACAATCGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144761.1-230s1c1
Sequence:CCGGGCGACTCCATTCGTTCCTGCTCTCGAGAGCAGGAACGAATGGAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144761.1-369s1c1
Sequence:CCGGCAGTGAAATCCACTCCCTCAACTCGAGTTGAGGGAGTGGATTTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144761.1-270s1c1
Sequence:CCGGTGGCACTTACAGAATGAGGATCTCGAGATCCTCATTCTGTAAGTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005210
CRYGB MISSION shRNA Bacterial Glycerol Stock
crystallin, gamma B
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000148941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005210.2-108s1c1
Sequence:CCGGCAACCTACAACCCTATTTCAGCTCGAGCTGAAATAGGGTTGTAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005210.2-297s1c1
Sequence:CCGGCGCTTACAGAATGAAGATCTACTCGAGTAGATCTTCATTCTGTAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005210.2-107s1c1
Sequence:CCGGCCAACCTACAACCCTATTTCACTCGAGTGAAATAGGGTTGTAGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005210.2-384s1c1
Sequence:CCGGCTTCCACCTCACTGAAATTCACTCGAGTGAATTTCAGTGAGGTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005210.2-298s1c1
Sequence:CCGGGCTTACAGAATGAAGATCTACCTCGAGGTAGATCTTCATTCTGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005210.2-393s1c1
Sequence:CCGGCACTGAAATTCACTCCCTCAACTCGAGTTGAGGGAGTGAATTTCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005210.3-346s21c1
Sequence:CCGGGAGCTCACAGACGACTGTATCCTCGAGGATACAGTCGTCTGTGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005210.3-486s21c1
Sequence:CCGGGTACAGGAGGTTTCTTGATTGCTCGAGCAATCAAGAAACCTCCTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005210.3-82s21c1
Sequence:CCGGTACGAATGCACCACTGACTGCCTCGAGGCAGTCAGTGGTGCATTCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005210.3-519s21c1
Sequence:CCGGTGCCAAAGTTGGCTCTCTTAGCTCGAGCTAAGAGAGCCAACTTTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005210
CRYGB MISSION shRNA shRNA Plasmid DNA
crystallin, gamma B
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000148941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005210.2-108s1c1
Sequence:CCGGCAACCTACAACCCTATTTCAGCTCGAGCTGAAATAGGGTTGTAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005210.2-297s1c1
Sequence:CCGGCGCTTACAGAATGAAGATCTACTCGAGTAGATCTTCATTCTGTAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005210.2-107s1c1
Sequence:CCGGCCAACCTACAACCCTATTTCACTCGAGTGAAATAGGGTTGTAGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005210.2-384s1c1
Sequence:CCGGCTTCCACCTCACTGAAATTCACTCGAGTGAATTTCAGTGAGGTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005210.2-298s1c1
Sequence:CCGGGCTTACAGAATGAAGATCTACCTCGAGGTAGATCTTCATTCTGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005210.2-393s1c1
Sequence:CCGGCACTGAAATTCACTCCCTCAACTCGAGTTGAGGGAGTGAATTTCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005210.3-346s21c1
Sequence:CCGGGAGCTCACAGACGACTGTATCCTCGAGGATACAGTCGTCTGTGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005210.3-486s21c1
Sequence:CCGGGTACAGGAGGTTTCTTGATTGCTCGAGCAATCAAGAAACCTCCTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005210.3-82s21c1
Sequence:CCGGTACGAATGCACCACTGACTGCCTCGAGGCAGTCAGTGGTGCATTCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005210.3-519s21c1
Sequence:CCGGTGCCAAAGTTGGCTCTCTTAGCTCGAGCTAAGAGAGCCAACTTTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005210
CRYGB MISSION shRNA Lentiviral Transduction Particles
crystallin, gamma B
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000148941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005210.2-108s1c1
Sequence:CCGGCAACCTACAACCCTATTTCAGCTCGAGCTGAAATAGGGTTGTAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005210.2-297s1c1
Sequence:CCGGCGCTTACAGAATGAAGATCTACTCGAGTAGATCTTCATTCTGTAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005210.2-107s1c1
Sequence:CCGGCCAACCTACAACCCTATTTCACTCGAGTGAAATAGGGTTGTAGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005210.2-384s1c1
Sequence:CCGGCTTCCACCTCACTGAAATTCACTCGAGTGAATTTCAGTGAGGTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005210.2-298s1c1
Sequence:CCGGGCTTACAGAATGAAGATCTACCTCGAGGTAGATCTTCATTCTGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005210.2-393s1c1
Sequence:CCGGCACTGAAATTCACTCCCTCAACTCGAGTTGAGGGAGTGAATTTCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005210.3-346s21c1
Sequence:CCGGGAGCTCACAGACGACTGTATCCTCGAGGATACAGTCGTCTGTGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005210.3-486s21c1
Sequence:CCGGGTACAGGAGGTTTCTTGATTGCTCGAGCAATCAAGAAACCTCCTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005210.3-82s21c1
Sequence:CCGGTACGAATGCACCACTGACTGCCTCGAGGCAGTCAGTGGTGCATTCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005210.3-519s21c1
Sequence:CCGGTGCCAAAGTTGGCTCTCTTAGCTCGAGCTAAGAGAGCCAACTTTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks