EMAIL THIS PAGE TO A FRIEND

CRYGC

crystallin, gamma C

69 Gene Product Result for
Synonyms: CCL CRYG3 CTRCT2
UniProtKB ID: P07315, Q53R50
Gene ID:
Human(1420) Summary: Crystallins are separated into two classes: taxon-specific, or enzyme, and ubiquitous. The latter class constitutes the major proteins of vertebrate eye lens and maintains the transparency and refractive index of the lens. Since lens central fiber cells lose their nuclei during development, these crystallins are made and then retained throughout life, making them extremely stable proteins. Mammalian lens crystallins are divided into alpha, beta, and gamma families; beta and gamma crystallins are also considered as a superfamily. Alpha and beta families are further divided into acidic and basic groups. Seven protein regions exist in crystallins: four homologous motifs, a connecting peptide, and N- and C-terminal extensions. Gamma-crystallins are a homogeneous group of highly symmetrical, monomeric proteins typically lacking connecting peptides and terminal extensions. They are differentially regulated after early development. Four gamma-crystallin genes (gamma-A through gamma-D) and three pseudogenes (gamma-E, gamma-F, gamma-G) are tandemly organized in a genomic segment as a gene cluster. Whether due to aging or mutations in specific genes, gamma-crystallins have been involved in cataract formation. [provided by RefSeq, Jul 2008]
Mouse(12966) crystallin, gamma C
Rat(24277) crystallin, gamma C
naked mole-rat(101725045) crystallin, gamma C
domestic guinea pig(100337641) crystallin, gamma C
sheep(101119537) crystallin, gamma C
dog(100126770) crystallin, gamma C
cow(281722) crystallin, gamma C
domestic cat(101093129) crystallin, gamma C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020989 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020989 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020989 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007775 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007775 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007775 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020989 Rosetta Predictions human pricing
NM_001081660 Rosetta Predictions rat pricing
NM_033483 Rosetta Predictions rat pricing
NM_001082573 Rosetta Predictions mouse pricing
NM_007775 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020989 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144919 predicted 299
2 SASI_Hs01_00144920 predicted 327
3 SASI_Hs01_00144922 predicted 306
4 SASI_Hs01_00144924 predicted 264
5 SASI_Hs01_00144925 predicted 328
6 SASI_Hs01_00144928 predicted 378
7 SASI_Hs02_00354446 predicted 392
8 SASI_Hs02_00354447 predicted 376
9 SASI_Hs02_00354448 predicted 373
10 SASI_Hs02_00354449 predicted 373
11 SASI_Hs01_00144921 predicted 266
12 SASI_Hs01_00144923 predicted 257
13 SASI_Hs01_00144926 predicted 250
14 SASI_Hs01_00144927 predicted 250
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081660 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00208629 predicted 289
2 SASI_Rn02_00208630 predicted 315
3 SASI_Rn02_00208631 predicted 389
4 SASI_Rn02_00208632 predicted 235
5 SASI_Rn02_00208633 predicted 285
6 SASI_Rn02_00208634 predicted 327
7 SASI_Rn02_00208635 predicted 320
8 SASI_Rn02_00208636 predicted 285
9 SASI_Rn02_00208637 predicted 359
10 SASI_Rn02_00208638 predicted 287
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033483 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00265558 predicted 269
2 SASI_Rn02_00265559 predicted 300
3 SASI_Rn02_00265560 predicted 369
4 SASI_Rn02_00265561 predicted 209
5 SASI_Rn02_00265562 predicted 269
6 SASI_Rn02_00265563 predicted 310
7 SASI_Rn02_00265564 predicted 308
8 SASI_Rn02_00265565 predicted 268
9 SASI_Rn02_00265566 predicted 343
10 SASI_Rn02_00265567 predicted 271
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001082573 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00299375 predicted 274
2 SASI_Mm02_00299376 predicted 277
3 SASI_Mm02_00299377 predicted 370
4 SASI_Mm02_00299378 predicted 277
5 SASI_Mm02_00299379 predicted 331
6 SASI_Mm02_00299380 predicted 376
7 SASI_Mm02_00299381 predicted 348
8 SASI_Mm02_00299382 predicted 335
9 SASI_Mm02_00299383 predicted 298
10 SASI_Mm02_00299384 predicted 347
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007775 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00049452 predicted 259
2 SASI_Mm01_00049453 predicted 261
3 SASI_Mm01_00049454 predicted 257
4 SASI_Mm01_00049455 predicted 286
5 SASI_Mm01_00049456 predicted 273
6 SASI_Mm01_00049457 predicted 253
7 SASI_Mm01_00049458 predicted 285
8 SASI_Mm01_00049459 predicted 261
9 SASI_Mm01_00049460 predicted 263
10 SASI_Mm01_00049461 predicted 295
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020989
CRYGC MISSION shRNA Bacterial Glycerol Stock
crystallin, gamma C
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000439264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020989.3-87s21c1
Sequence:CCGGTACGAAACCACCACTGACTGCCTCGAGGCAGTCAGTGGTGGTTTCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020989.2-257s1c1
Sequence:CCGGCCCAACTACCAAGGTCAACAACTCGAGTTGTTGACCTTGGTAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020989.2-189s1c1
Sequence:CCGGTGCAGCCGTATTTCAGCCGCTCTCGAGAGCGGCTGAAATACGGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020989.2-463s1c1
Sequence:CCGGCCTCAGCGAGATCCGTTCCCTCTCGAGAGGGAACGGATCTCGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020989.2-265s1c1
Sequence:CCGGCCAAGGTCAACAATACTTGCTCTCGAGAGCAAGTATTGTTGACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020989.2-400s1c1
Sequence:CCGGAGACCACAAAGGCCTCATGATCTCGAGATCATGAGGCCTTTGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020989
CRYGC MISSION shRNA shRNA Plasmid DNA
crystallin, gamma C
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000439264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020989.3-87s21c1
Sequence:CCGGTACGAAACCACCACTGACTGCCTCGAGGCAGTCAGTGGTGGTTTCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020989.2-257s1c1
Sequence:CCGGCCCAACTACCAAGGTCAACAACTCGAGTTGTTGACCTTGGTAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020989.2-189s1c1
Sequence:CCGGTGCAGCCGTATTTCAGCCGCTCTCGAGAGCGGCTGAAATACGGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020989.2-463s1c1
Sequence:CCGGCCTCAGCGAGATCCGTTCCCTCTCGAGAGGGAACGGATCTCGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020989.2-265s1c1
Sequence:CCGGCCAAGGTCAACAATACTTGCTCTCGAGAGCAAGTATTGTTGACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020989.2-400s1c1
Sequence:CCGGAGACCACAAAGGCCTCATGATCTCGAGATCATGAGGCCTTTGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020989
CRYGC MISSION shRNA Lentiviral Transduction Particles
crystallin, gamma C
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000439264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020989.3-87s21c1
Sequence:CCGGTACGAAACCACCACTGACTGCCTCGAGGCAGTCAGTGGTGGTTTCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020989.2-257s1c1
Sequence:CCGGCCCAACTACCAAGGTCAACAACTCGAGTTGTTGACCTTGGTAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020989.2-189s1c1
Sequence:CCGGTGCAGCCGTATTTCAGCCGCTCTCGAGAGCGGCTGAAATACGGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020989.2-463s1c1
Sequence:CCGGCCTCAGCGAGATCCGTTCCCTCTCGAGAGGGAACGGATCTCGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020989.2-265s1c1
Sequence:CCGGCCAAGGTCAACAATACTTGCTCTCGAGAGCAAGTATTGTTGACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020989.2-400s1c1
Sequence:CCGGAGACCACAAAGGCCTCATGATCTCGAGATCATGAGGCCTTTGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007775
CRYGC MISSION shRNA Bacterial Glycerol Stock
crystallin, gamma C
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007775.1-271s1c1
Sequence:CCGGCGGCTGTATGAGAAAGAAGATCTCGAGATCTTCTTTCTCATACAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007775.1-249s1c1
Sequence:CCGGCCATGCAGGTTCCCACAGAATCTCGAGATTCTGTGGGAACCTGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007775.1-276s1c1
Sequence:CCGGGTATGAGAAAGAAGATCACAACTCGAGTTGTGATCTTCTTTCTCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007775.1-177s1c1
Sequence:CCGGACGTGGAGAGTACCCTGACTACTCGAGTAGTCAGGGTACTCTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007775.1-315s1c1
Sequence:CCGGGAGCGAGGATTGCTCCTGCATCTCGAGATGCAGGAGCAATCCTCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007775
CRYGC MISSION shRNA shRNA Plasmid DNA
crystallin, gamma C
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007775.1-271s1c1
Sequence:CCGGCGGCTGTATGAGAAAGAAGATCTCGAGATCTTCTTTCTCATACAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007775.1-249s1c1
Sequence:CCGGCCATGCAGGTTCCCACAGAATCTCGAGATTCTGTGGGAACCTGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007775.1-276s1c1
Sequence:CCGGGTATGAGAAAGAAGATCACAACTCGAGTTGTGATCTTCTTTCTCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007775.1-177s1c1
Sequence:CCGGACGTGGAGAGTACCCTGACTACTCGAGTAGTCAGGGTACTCTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007775.1-315s1c1
Sequence:CCGGGAGCGAGGATTGCTCCTGCATCTCGAGATGCAGGAGCAATCCTCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007775
CRYGC MISSION shRNA Lentiviral Transduction Particles
crystallin, gamma C
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007775.1-271s1c1
Sequence:CCGGCGGCTGTATGAGAAAGAAGATCTCGAGATCTTCTTTCTCATACAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007775.1-249s1c1
Sequence:CCGGCCATGCAGGTTCCCACAGAATCTCGAGATTCTGTGGGAACCTGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007775.1-276s1c1
Sequence:CCGGGTATGAGAAAGAAGATCACAACTCGAGTTGTGATCTTCTTTCTCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007775.1-177s1c1
Sequence:CCGGACGTGGAGAGTACCCTGACTACTCGAGTAGTCAGGGTACTCTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007775.1-315s1c1
Sequence:CCGGGAGCGAGGATTGCTCCTGCATCTCGAGATGCAGGAGCAATCCTCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks