EMAIL THIS PAGE TO A FRIEND

CRYGD

crystallin, gamma D

Synonyms: CACA CCA3 CCP CRYG4 CTRCT4 PCC cry-g-D
UniProtKB ID: P07320, Q17RF7, Q53R51, Q99681
Gene ID:
Human(1421) Summary: Crystallins are separated into two classes: taxon-specific, or enzyme, and ubiquitous. The latter class constitutes the major proteins of vertebrate eye lens and maintains the transparency and refractive index of the lens. Since lens central fiber cells lose their nuclei during development, these crystallins are made and then retained throughout life, making them extremely stable proteins. Mammalian lens crystallins are divided into alpha, beta, and gamma families; beta and gamma crystallins are also considered as a superfamily. Alpha and beta families are further divided into acidic and basic groups. Seven protein regions exist in crystallins: four homologous motifs, a connecting peptide, and N- and C-terminal extensions. Gamma-crystallins are a homogeneous group of highly symmetrical, monomeric proteins typically lacking connecting peptides and terminal extensions. They are differentially regulated after early development. Four gamma-crystallin genes (gamma-A through gamma-D) and three pseudogenes (gamma-E, gamma-F, gamma-G) are tandemly organized in a genomic segment as a gene cluster. Whether due to aging or mutations in specific genes, gamma-crystallins have been involved in cataract formation. [provided by RefSeq, Jul 2008]
Mouse(12967) crystallin, gamma D
Rat(24278) crystallin, gamma D
dog(488495) crystallin, gamma D
cow(281723) crystallin, gamma D
domestic cat(101092875) crystallin, gamma D
sheep(101106832) crystallin, gamma D
58 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007776 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007776 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007776 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006891 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006891 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006891 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU163311 MISSION® esiRNA esiRNA targeting mouse Crygd mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006891 Rosetta Predictions human pricing
NM_033095 Rosetta Predictions rat pricing
NM_007776 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006891 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028392 predicted 371
2 SASI_Hs01_00028388 predicted 400
3 SASI_Hs02_00342558 predicted 385
4 SASI_Hs01_00028395 predicted 397
5 SASI_Hs02_00342559 predicted 458
6 SASI_Hs02_00342560 predicted 365
7 SASI_Hs02_00342561 predicted 373
8 SASI_Hs02_00342562 predicted 368
9 SASI_Hs02_00342563 predicted 292
10 SASI_Hs02_00342564 predicted 432
11 SASI_Hs01_00028387 predicted 351
12 SASI_Hs01_00028389 predicted 319
13 SASI_Hs01_00028390 predicted 290
14 SASI_Hs01_00028391 predicted 356
15 SASI_Hs01_00028393 predicted 313
16 SASI_Hs01_00028394 predicted 358
17 SASI_Hs01_00028396 predicted 288
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033095 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00265501 predicted 313
2 SASI_Rn01_00085982 predicted 287
3 SASI_Rn01_00085983 predicted 378
4 SASI_Rn01_00085984 predicted 339
5 SASI_Rn01_00085985 predicted 294
6 SASI_Rn01_00085986 predicted 377
7 SASI_Rn01_00085987 predicted 396
8 SASI_Rn01_00085988 predicted 331
9 SASI_Rn01_00085989 predicted 383
10 SASI_Rn02_00265502 predicted 319
11 SASI_Rn01_00085990 predicted 386
12 SASI_Rn01_00085991 predicted 368
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007776 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00188869 predicted 294
2 SASI_Mm01_00188870 predicted 374
3 SASI_Mm01_00188872 predicted 370
4 SASI_Mm01_00188873 predicted 285
5 SASI_Mm01_00188874 predicted 389
6 SASI_Mm02_00312419 predicted 320
7 SASI_Mm01_00188876 predicted 370
8 SASI_Mm02_00312420 predicted 294
9 SASI_Mm02_00312421 predicted 324
10 SASI_Mm02_00312422 predicted 391
11 SASI_Mm01_00188871 predicted 293
12 SASI_Mm01_00188875 predicted 298
13 SASI_Mm01_00188877 predicted 307
14 SASI_Mm01_00188878 predicted 309
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007776
CRYGD MISSION shRNA Bacterial Glycerol Stock
crystallin, gamma D
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007776.1-349s1c1
Sequence:CCGGCCGATTCCACTTCAATGAGATCTCGAGATCTCATTGAAGTGGAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007776.1-265s1c1
Sequence:CCGGCTCTCACAGGATCAGACTGTACTCGAGTACAGTCTGATCCTGTGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007776.1-52s1c1
Sequence:CCGGCCACTATGAGTGCAGCACCGACTCGAGTCGGTGCTGCACTCATAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007776.1-361s1c1
Sequence:CCGGCAATGAGATCTACTCCCTCAACTCGAGTTGAGGGAGTAGATCTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007776.1-308s1c1
Sequence:CCGGCAAGTGATAGAGTTCACGGAACTCGAGTTCCGTGAACTCTATCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007776
CRYGD MISSION shRNA shRNA Plasmid DNA
crystallin, gamma D
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007776.1-349s1c1
Sequence:CCGGCCGATTCCACTTCAATGAGATCTCGAGATCTCATTGAAGTGGAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007776.1-265s1c1
Sequence:CCGGCTCTCACAGGATCAGACTGTACTCGAGTACAGTCTGATCCTGTGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007776.1-52s1c1
Sequence:CCGGCCACTATGAGTGCAGCACCGACTCGAGTCGGTGCTGCACTCATAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007776.1-361s1c1
Sequence:CCGGCAATGAGATCTACTCCCTCAACTCGAGTTGAGGGAGTAGATCTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007776.1-308s1c1
Sequence:CCGGCAAGTGATAGAGTTCACGGAACTCGAGTTCCGTGAACTCTATCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007776
CRYGD MISSION shRNA Lentiviral Transduction Particles
crystallin, gamma D
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007776.1-349s1c1
Sequence:CCGGCCGATTCCACTTCAATGAGATCTCGAGATCTCATTGAAGTGGAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007776.1-265s1c1
Sequence:CCGGCTCTCACAGGATCAGACTGTACTCGAGTACAGTCTGATCCTGTGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007776.1-52s1c1
Sequence:CCGGCCACTATGAGTGCAGCACCGACTCGAGTCGGTGCTGCACTCATAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007776.1-361s1c1
Sequence:CCGGCAATGAGATCTACTCCCTCAACTCGAGTTGAGGGAGTAGATCTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007776.1-308s1c1
Sequence:CCGGCAAGTGATAGAGTTCACGGAACTCGAGTTCCGTGAACTCTATCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006891
CRYGD MISSION shRNA Bacterial Glycerol Stock
crystallin, gamma D
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006891.2-358s1c1
Sequence:CCGGCCGCTTCCGCTTCAATGAAATCTCGAGATTTCATTGAAGCGGAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006891.2-310s1c1
Sequence:CCGGCAGAGGCCAGATGATAGAGTTCTCGAGAACTCTATCATCTGGCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006891.2-419s1c1
Sequence:CCGGGAGCTGTCCAACTACCGAGGACTCGAGTCCTCGGTAGTTGGACAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006891.2-61s1c1
Sequence:CCGGCCACTACGAATGCAGCAGCGACTCGAGTCGCTGCTGCATTCGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006891.2-289s1c1
Sequence:CCGGACTCTATGAGAGGGAGGACTACTCGAGTAGTCCTCCCTCTCATAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006891
CRYGD MISSION shRNA shRNA Plasmid DNA
crystallin, gamma D
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006891.2-358s1c1
Sequence:CCGGCCGCTTCCGCTTCAATGAAATCTCGAGATTTCATTGAAGCGGAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006891.2-310s1c1
Sequence:CCGGCAGAGGCCAGATGATAGAGTTCTCGAGAACTCTATCATCTGGCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006891.2-419s1c1
Sequence:CCGGGAGCTGTCCAACTACCGAGGACTCGAGTCCTCGGTAGTTGGACAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006891.2-61s1c1
Sequence:CCGGCCACTACGAATGCAGCAGCGACTCGAGTCGCTGCTGCATTCGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006891.2-289s1c1
Sequence:CCGGACTCTATGAGAGGGAGGACTACTCGAGTAGTCCTCCCTCTCATAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006891
CRYGD MISSION shRNA Lentiviral Transduction Particles
crystallin, gamma D
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006891.2-358s1c1
Sequence:CCGGCCGCTTCCGCTTCAATGAAATCTCGAGATTTCATTGAAGCGGAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006891.2-310s1c1
Sequence:CCGGCAGAGGCCAGATGATAGAGTTCTCGAGAACTCTATCATCTGGCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006891.2-419s1c1
Sequence:CCGGGAGCTGTCCAACTACCGAGGACTCGAGTCCTCGGTAGTTGGACAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006891.2-61s1c1
Sequence:CCGGCCACTACGAATGCAGCAGCGACTCGAGTCGCTGCTGCATTCGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006891.2-289s1c1
Sequence:CCGGACTCTATGAGAGGGAGGACTACTCGAGTAGTCCTCCCTCTCATAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks