EMAIL THIS PAGE TO A FRIEND

CRYGN

crystallin, gamma N

47 Gene Product Result for
UniProtKB ID: Q8WXF5, Q496G6
Gene ID:
Human(155051) Summary: The beta and gamma crystallins are evolutionarily related families of proteins that are localized to the refractive structure of the eye lens. The protein encoded by this gene is unique in that it has both beta and gamma crystallin protein motifs. [provided by RefSeq, Jul 2008]
Mouse(214301) crystallin, gamma N
Rat(296730) crystallin, gamma N
chicken(428406) crystallin, gamma N
dog(611008) crystallin, gamma N
domestic cat(101099870) crystallin, gamma N
cow(519041) crystallin, gamma N
domestic guinea pig(100307055) crystallin, gamma N
naked mole-rat(101701786) crystallin, gamma N
sheep(101115362) crystallin, gamma N
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153076 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153076 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153076 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_144727 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144727 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144727 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144727 Rosetta Predictions human pricing
NM_001106573 Rosetta Predictions rat pricing
NM_153076 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144727 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00202357 predicted 340
2 SASI_Hs01_00202358 predicted 461
3 SASI_Hs01_00202359 predicted 233
4 SASI_Hs01_00202361 predicted 365
5 SASI_Hs02_00364681 predicted 337
6 SASI_Hs01_00202362 predicted 223
7 SASI_Hs01_00202364 predicted 346
8 SASI_Hs02_00364682 predicted 231
9 SASI_Hs02_00364683 predicted 226
10 SASI_Hs01_00202366 predicted 378
11 SASI_Hs01_00202360 predicted 271
12 SASI_Hs01_00202363 predicted 470
13 SASI_Hs01_00202365 predicted 418
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106573 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00220288 predicted 82
2 SASI_Rn02_00220289 predicted 78
3 SASI_Rn02_00220290 predicted 190
4 SASI_Rn02_00220291 predicted 238
5 SASI_Rn02_00220292 predicted 378
6 SASI_Rn02_00220293 predicted 105
7 SASI_Rn02_00220294 predicted 279
8 SASI_Rn02_00220295 predicted 365
9 SASI_Rn02_00220296 predicted 208
10 SASI_Rn02_00220297 predicted 280
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153076 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00061805 predicted 271
2 SASI_Mm01_00061806 predicted 218
3 SASI_Mm02_00342904 predicted 378
4 SASI_Mm01_00061807 predicted 308
5 SASI_Mm01_00061808 predicted 307
6 SASI_Mm01_00061809 predicted 300
7 SASI_Mm01_00061810 predicted 250
8 SASI_Mm01_00061811 predicted 376
9 SASI_Mm01_00061812 predicted 255
10 SASI_Mm01_00061814 predicted 293
11 SASI_Mm01_00061813 predicted 208
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153076
CRYGN MISSION shRNA Bacterial Glycerol Stock
crystallin, gamma N
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153076.1-208s1c1
Sequence:CCGGCCTGAATTCTTCCGCTGGAATCTCGAGATTCCAGCGGAAGAATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153076.1-271s1c1
Sequence:CCGGCATGGAGAGCATTTCCGCATACTCGAGTATGCGGAAATGCTCTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153076.1-276s1c1
Sequence:CCGGAGAGCATTTCCGCATAGACATCTCGAGATGTCTATGCGGAAATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153076.1-385s1c1
Sequence:CCGGGTCAACGCCATCAAGGTGTATCTCGAGATACACCTTGATGGCGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153076.1-99s1c1
Sequence:CCGGAGGCTTTATGAACCGGGTGAACTCGAGTTCACCCGGTTCATAAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153076
CRYGN MISSION shRNA shRNA Plasmid DNA
crystallin, gamma N
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153076.1-208s1c1
Sequence:CCGGCCTGAATTCTTCCGCTGGAATCTCGAGATTCCAGCGGAAGAATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153076.1-271s1c1
Sequence:CCGGCATGGAGAGCATTTCCGCATACTCGAGTATGCGGAAATGCTCTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153076.1-276s1c1
Sequence:CCGGAGAGCATTTCCGCATAGACATCTCGAGATGTCTATGCGGAAATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153076.1-385s1c1
Sequence:CCGGGTCAACGCCATCAAGGTGTATCTCGAGATACACCTTGATGGCGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153076.1-99s1c1
Sequence:CCGGAGGCTTTATGAACCGGGTGAACTCGAGTTCACCCGGTTCATAAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153076
CRYGN MISSION shRNA Lentiviral Transduction Particles
crystallin, gamma N
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153076.1-208s1c1
Sequence:CCGGCCTGAATTCTTCCGCTGGAATCTCGAGATTCCAGCGGAAGAATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153076.1-271s1c1
Sequence:CCGGCATGGAGAGCATTTCCGCATACTCGAGTATGCGGAAATGCTCTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153076.1-276s1c1
Sequence:CCGGAGAGCATTTCCGCATAGACATCTCGAGATGTCTATGCGGAAATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153076.1-385s1c1
Sequence:CCGGGTCAACGCCATCAAGGTGTATCTCGAGATACACCTTGATGGCGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153076.1-99s1c1
Sequence:CCGGAGGCTTTATGAACCGGGTGAACTCGAGTTCACCCGGTTCATAAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144727
CRYGN MISSION shRNA Bacterial Glycerol Stock
crystallin, gamma N
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000153909    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144727.1-471s1c1
Sequence:CCGGCAAGAACTGTGTGAACACCATCTCGAGATGGTGTTCACACAGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144727.1-197s1c1
Sequence:CCGGGCTTTATGAACCGAGTGAACTCTCGAGAGTTCACTCGGTTCATAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144727.1-474s1c1
Sequence:CCGGGAACTGTGTGAACACCATCAACTCGAGTTGATGGTGTTCACACAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144727.1-371s1c1
Sequence:CCGGGAGAACATTTCCGCCTAGAAACTCGAGTTTCTAGGCGGAAATGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153528    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144727.1-563s1c1
Sequence:CCGGCTCTTCAATCAGATCAAGGACCTCGAGGTCCTTGATCTGATTGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158203    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144727.1-124s1c1
Sequence:CCGGCTCTATGAAGGCAAGCACTTCCTCGAGGAAGTGCTTGCCTTCATAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157345    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144727.1-465s1c1
Sequence:CCGGCTGGGTCAAGAACTGTGTGAACTCGAGTTCACACAGTTCTTGACCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144727.1-358s1c1
Sequence:CCGGGTAGGAATGCACGGAGAACATCTCGAGATGTTCTCCGTGCATTCCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144727.1-555s1c1
Sequence:CCGGGAGCAGCTCTCTTCAATCAGACTCGAGTCTGATTGAAGAGAGCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156876    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144727.1-383s1c1
Sequence:CCGGGCCTAGAAATCTTCGAGGGTTCTCGAGAACCCTCGAAGATTTCTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157301    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144727.1-568s1c1
Sequence:CCGGCAATCAGATCAAGGACCGGAACTCGAGTTCCGGTCCTTGATCTGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157593    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144727.1-481s1c1
Sequence:CCGGGTGAACACCATCAAGGTGTACCTCGAGGTACACCTTGATGGTGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144727
CRYGN MISSION shRNA shRNA Plasmid DNA
crystallin, gamma N
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000153909    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144727.1-471s1c1
Sequence:CCGGCAAGAACTGTGTGAACACCATCTCGAGATGGTGTTCACACAGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144727.1-197s1c1
Sequence:CCGGGCTTTATGAACCGAGTGAACTCTCGAGAGTTCACTCGGTTCATAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144727.1-474s1c1
Sequence:CCGGGAACTGTGTGAACACCATCAACTCGAGTTGATGGTGTTCACACAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144727.1-371s1c1
Sequence:CCGGGAGAACATTTCCGCCTAGAAACTCGAGTTTCTAGGCGGAAATGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153528    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144727.1-563s1c1
Sequence:CCGGCTCTTCAATCAGATCAAGGACCTCGAGGTCCTTGATCTGATTGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158203    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144727.1-124s1c1
Sequence:CCGGCTCTATGAAGGCAAGCACTTCCTCGAGGAAGTGCTTGCCTTCATAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157345    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144727.1-465s1c1
Sequence:CCGGCTGGGTCAAGAACTGTGTGAACTCGAGTTCACACAGTTCTTGACCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144727.1-358s1c1
Sequence:CCGGGTAGGAATGCACGGAGAACATCTCGAGATGTTCTCCGTGCATTCCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144727.1-555s1c1
Sequence:CCGGGAGCAGCTCTCTTCAATCAGACTCGAGTCTGATTGAAGAGAGCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156876    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144727.1-383s1c1
Sequence:CCGGGCCTAGAAATCTTCGAGGGTTCTCGAGAACCCTCGAAGATTTCTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157301    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144727.1-568s1c1
Sequence:CCGGCAATCAGATCAAGGACCGGAACTCGAGTTCCGGTCCTTGATCTGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157593    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144727.1-481s1c1
Sequence:CCGGGTGAACACCATCAAGGTGTACCTCGAGGTACACCTTGATGGTGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144727
CRYGN MISSION shRNA Lentiviral Transduction Particles
crystallin, gamma N
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000153909    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144727.1-471s1c1
Sequence:CCGGCAAGAACTGTGTGAACACCATCTCGAGATGGTGTTCACACAGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144727.1-197s1c1
Sequence:CCGGGCTTTATGAACCGAGTGAACTCTCGAGAGTTCACTCGGTTCATAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144727.1-474s1c1
Sequence:CCGGGAACTGTGTGAACACCATCAACTCGAGTTGATGGTGTTCACACAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144727.1-371s1c1
Sequence:CCGGGAGAACATTTCCGCCTAGAAACTCGAGTTTCTAGGCGGAAATGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153528    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144727.1-563s1c1
Sequence:CCGGCTCTTCAATCAGATCAAGGACCTCGAGGTCCTTGATCTGATTGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158203    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144727.1-124s1c1
Sequence:CCGGCTCTATGAAGGCAAGCACTTCCTCGAGGAAGTGCTTGCCTTCATAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157345    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144727.1-465s1c1
Sequence:CCGGCTGGGTCAAGAACTGTGTGAACTCGAGTTCACACAGTTCTTGACCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144727.1-358s1c1
Sequence:CCGGGTAGGAATGCACGGAGAACATCTCGAGATGTTCTCCGTGCATTCCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144727.1-555s1c1
Sequence:CCGGGAGCAGCTCTCTTCAATCAGACTCGAGTCTGATTGAAGAGAGCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156876    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144727.1-383s1c1
Sequence:CCGGGCCTAGAAATCTTCGAGGGTTCTCGAGAACCCTCGAAGATTTCTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157301    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144727.1-568s1c1
Sequence:CCGGCAATCAGATCAAGGACCGGAACTCGAGTTCCGGTCCTTGATCTGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157593    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144727.1-481s1c1
Sequence:CCGGGTGAACACCATCAAGGTGTACCTCGAGGTACACCTTGATGGTGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks