EMAIL THIS PAGE TO A FRIEND

CRYGS

crystallin, gamma S

51 Gene Product Result for
Synonyms: CRYG8 CTRCT20
UniProtKB ID: P22914, B2RAF8
Gene ID:
Human(1427) Summary: Crystallins are separated into two classes: taxon-specific, or enzyme, and ubiquitous. The latter class constitutes the major proteins of vertebrate eye lens and maintains the transparency and refractive index of the lens. Since lens central fiber cells lose their nuclei during development, these crystallins are made and then retained throughout life, making them extremely stable proteins. Mammalian lens crystallins are divided into alpha, beta, and gamma families; beta and gamma crystallins are also considered as a superfamily. Alpha and beta families are further divided into acidic and basic groups. Seven protein regions exist in crystallins: four homologous motifs, a connecting peptide, and N- and C-terminal extensions. Gamma-crystallins are a homogeneous group of highly symmetrical, monomeric proteins typically lacking connecting peptides and terminal extensions. They are differentially regulated after early development. This gene encodes a protein initially considered to be a beta-crystallin but the encoded protein is monomeric and has greater sequence similarity to other gamma-crystallins. This gene encodes the most significant gamma-crystallin in adult eye lens tissue. Whether due to aging or mutations in specific genes, gamma-crystallins have been involved in cataract formation. [provided by RefSeq, Jul 2008]
Mouse(12970) crystallin, gamma S
Rat(689897) crystallin, gamma S
chicken(429134) crystallin, gamma S
cow(281724) crystallin, gamma S
domestic cat(101100585) crystallin, gamma S
dog(607506) crystallin, gamma S
sheep(101114405) crystallin, gamma S
Domestic Rabbit(100101573) crystallin, gamma S
naked mole-rat(101725823) crystallin, gamma S
domestic guinea pig(100307056) crystallin, gamma S
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0577 AQUA Peptide SPAVQSFRR[I]VE human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017541 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017541 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017541 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009967 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009967 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009967 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU011061 MISSION® esiRNA esiRNA targeting mouse Crygs (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017541 Rosetta Predictions human pricing
NM_001109553 Rosetta Predictions rat pricing
NM_009967 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017541 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00101747 predicted 403
2 SASI_Hs02_00350166 predicted 395
3 SASI_Hs01_00101748 predicted 316
4 SASI_Hs01_00101749 predicted 327
5 SASI_Hs01_00101750 predicted 244
6 SASI_Hs02_00350167 predicted 310
7 SASI_Hs01_00101751 predicted 571
8 SASI_Hs01_00101752 predicted 218
9 SASI_Hs01_00101754 predicted 200
10 SASI_Hs02_00350168 predicted 572
11 SASI_Hs01_00101753 predicted 392
12 SASI_Hs01_00101755 predicted 265
13 SASI_Hs01_00101756 predicted 575
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109553 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00249529 predicted 325
2 SASI_Rn02_00249530 predicted 424
3 SASI_Rn02_00249531 predicted 445
4 SASI_Rn02_00249532 predicted 259
5 SASI_Rn02_00249533 predicted 408
6 SASI_Rn02_00249534 predicted 240
7 SASI_Rn02_00249535 predicted 322
8 SASI_Rn02_00249536 predicted 296
9 SASI_Rn02_00249537 predicted 400
10 SASI_Rn02_00249538 predicted 474
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009967 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00141699 predicted 346
2 SASI_Mm01_00141700 predicted 256
3 SASI_Mm01_00141701 predicted 236
4 SASI_Mm01_00141702 predicted 206
5 SASI_Mm01_00141703 predicted 349
6 SASI_Mm01_00141704 predicted 403
7 SASI_Mm01_00141705 predicted 352
8 SASI_Mm01_00141706 predicted 209
9 SASI_Mm01_00141707 predicted 378
10 SASI_Mm01_00141708 predicted 347
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017541
CRYGS MISSION shRNA Bacterial Glycerol Stock
crystallin, gamma S
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017541.2-371s1c1
Sequence:CCGGCAGATGTATGAAACCACCGAACTCGAGTTCGGTGGTTTCATACATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017541.2-197s1c1
Sequence:CCGGGTTTATGAAAGGCCCAACTTTCTCGAGAAAGTTGGGCCTTTCATAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017541.2-327s1c1
Sequence:CCGGGCCAGTATAAGATTCAGATCTCTCGAGAGATCTGAATCTTATACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017541.2-134s1c1
Sequence:CCGGGCAGATTTCCACACATACCTACTCGAGTAGGTATGTGTGGAAATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180729    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017541.2-679s1c1
Sequence:CCGGGCATCCCACTGCTGACTATAACTCGAGTTATAGTCAGCAGTGGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017541.2-398s21c1
Sequence:CCGGCCTTCCATCATGGAGCAATTTCTCGAGAAATTGCTCCATGATGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017541.2-572s21c1
Sequence:CCGGCGCCGCATTGTGGAGTAATGACTCGAGTCATTACTCCACAATGCGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412495    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017541.2-692s21c1
Sequence:CCGGGACTATAATGCCTCTCCTTAACTCGAGTTAAGGAGAGGCATTATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017541.2-519s21c1
Sequence:CCGGAGTACCGGAAGCCCATCGATTCTCGAGAATCGATGGGCTTCCGGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017541
CRYGS MISSION shRNA shRNA Plasmid DNA
crystallin, gamma S
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017541.2-371s1c1
Sequence:CCGGCAGATGTATGAAACCACCGAACTCGAGTTCGGTGGTTTCATACATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017541.2-197s1c1
Sequence:CCGGGTTTATGAAAGGCCCAACTTTCTCGAGAAAGTTGGGCCTTTCATAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017541.2-327s1c1
Sequence:CCGGGCCAGTATAAGATTCAGATCTCTCGAGAGATCTGAATCTTATACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017541.2-134s1c1
Sequence:CCGGGCAGATTTCCACACATACCTACTCGAGTAGGTATGTGTGGAAATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180729    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017541.2-679s1c1
Sequence:CCGGGCATCCCACTGCTGACTATAACTCGAGTTATAGTCAGCAGTGGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017541.2-398s21c1
Sequence:CCGGCCTTCCATCATGGAGCAATTTCTCGAGAAATTGCTCCATGATGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017541.2-572s21c1
Sequence:CCGGCGCCGCATTGTGGAGTAATGACTCGAGTCATTACTCCACAATGCGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412495    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017541.2-692s21c1
Sequence:CCGGGACTATAATGCCTCTCCTTAACTCGAGTTAAGGAGAGGCATTATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017541.2-519s21c1
Sequence:CCGGAGTACCGGAAGCCCATCGATTCTCGAGAATCGATGGGCTTCCGGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017541
CRYGS MISSION shRNA Lentiviral Transduction Particles
crystallin, gamma S
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017541.2-371s1c1
Sequence:CCGGCAGATGTATGAAACCACCGAACTCGAGTTCGGTGGTTTCATACATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017541.2-197s1c1
Sequence:CCGGGTTTATGAAAGGCCCAACTTTCTCGAGAAAGTTGGGCCTTTCATAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017541.2-327s1c1
Sequence:CCGGGCCAGTATAAGATTCAGATCTCTCGAGAGATCTGAATCTTATACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017541.2-134s1c1
Sequence:CCGGGCAGATTTCCACACATACCTACTCGAGTAGGTATGTGTGGAAATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180729    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017541.2-679s1c1
Sequence:CCGGGCATCCCACTGCTGACTATAACTCGAGTTATAGTCAGCAGTGGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017541.2-398s21c1
Sequence:CCGGCCTTCCATCATGGAGCAATTTCTCGAGAAATTGCTCCATGATGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017541.2-572s21c1
Sequence:CCGGCGCCGCATTGTGGAGTAATGACTCGAGTCATTACTCCACAATGCGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412495    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017541.2-692s21c1
Sequence:CCGGGACTATAATGCCTCTCCTTAACTCGAGTTAAGGAGAGGCATTATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017541.2-519s21c1
Sequence:CCGGAGTACCGGAAGCCCATCGATTCTCGAGAATCGATGGGCTTCCGGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009967
CRYGS MISSION shRNA Bacterial Glycerol Stock
crystallin, gamma S
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009967.1-397s1c1
Sequence:CCGGCCTTCTATCATGGAGCAGTTTCTCGAGAAACTGCTCCATGATAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009967.1-195s1c1
Sequence:CCGGTGTGTATGAAAGGCCCAACTTCTCGAGAAGTTGGGCCTTTCATACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009967.1-492s1c1
Sequence:CCGGCAGACAGTATCTTCTGGATAACTCGAGTTATCCAGAAGATACTGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009967.1-357s1c1
Sequence:CCGGCGACTTCAACGGTCAGATGTACTCGAGTACATCTGACCGTTGAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009967.1-396s1c1
Sequence:CCGGTCCTTCTATCATGGAGCAGTTCTCGAGAACTGCTCCATGATAGAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009967
CRYGS MISSION shRNA shRNA Plasmid DNA
crystallin, gamma S
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009967.1-397s1c1
Sequence:CCGGCCTTCTATCATGGAGCAGTTTCTCGAGAAACTGCTCCATGATAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009967.1-195s1c1
Sequence:CCGGTGTGTATGAAAGGCCCAACTTCTCGAGAAGTTGGGCCTTTCATACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009967.1-492s1c1
Sequence:CCGGCAGACAGTATCTTCTGGATAACTCGAGTTATCCAGAAGATACTGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009967.1-357s1c1
Sequence:CCGGCGACTTCAACGGTCAGATGTACTCGAGTACATCTGACCGTTGAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009967.1-396s1c1
Sequence:CCGGTCCTTCTATCATGGAGCAGTTCTCGAGAACTGCTCCATGATAGAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009967
CRYGS MISSION shRNA Lentiviral Transduction Particles
crystallin, gamma S
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009967.1-397s1c1
Sequence:CCGGCCTTCTATCATGGAGCAGTTTCTCGAGAAACTGCTCCATGATAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009967.1-195s1c1
Sequence:CCGGTGTGTATGAAAGGCCCAACTTCTCGAGAAGTTGGGCCTTTCATACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009967.1-492s1c1
Sequence:CCGGCAGACAGTATCTTCTGGATAACTCGAGTTATCCAGAAGATACTGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009967.1-357s1c1
Sequence:CCGGCGACTTCAACGGTCAGATGTACTCGAGTACATCTGACCGTTGAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009967.1-396s1c1
Sequence:CCGGTCCTTCTATCATGGAGCAGTTCTCGAGAACTGCTCCATGATAGAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks