EMAIL THIS PAGE TO A FRIEND

CRYL1

crystallin, lambda 1

61 Gene Product Result for
Synonyms: GDH lambda-CRY
UniProtKB ID: Q9Y2S2, A0PJ43, B3KN92, Q0VDI1, Q7Z4Z9, Q9P0G7
Gene ID:
Human(51084) Summary: The uronate cycle functions as an alternative glucose metabolic pathway, accounting for about 5% of daily glucose catabolism. The product of this gene catalyzes the dehydrogenation of L-gulonate into dehydro-L-gulonate in the uronate cycle. The enzyme requires NAD(H) as a coenzyme, and is inhibited by inorganic phosphate. A similar gene in the rabbit is thought to serve a structural role in the lens of the eye. [provided by RefSeq, Jul 2008]
Mouse(68631) crystallin, lambda 1
Rat(290277) crystallin, lambda 1
Zebrafish(751596) crystallin, lambda 1
dog(486050) crystallin, lambda 1
cow(281725) crystallin, lambda 1
domestic cat(101092816) crystallin, lambda 1
chicken(418953) crystallin, lambda 1
domestic guinea pig(100724326) crystallin, lambda 1
naked mole-rat(101708457) crystallin, lambda 1
sheep(101118708) crystallin, lambda 1
Domestic Rabbit(100009108) crystallin, lambda 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015974 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015974 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015974 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030004 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030004 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030004 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015974 Rosetta Predictions human pricing
NM_175757 Rosetta Predictions rat pricing
NM_030004 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015974 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00083926 predicted 741
2 SASI_Hs01_00083920 predicted 509
3 SASI_Hs01_00083922 predicted 801
4 SASI_Hs01_00083923 predicted 943
5 SASI_Hs02_00348641 predicted 290
6 SASI_Hs01_00083925 predicted 1094
7 SASI_Hs01_00083928 predicted 830
8 SASI_Hs01_00083929 predicted 798
9 SASI_Hs02_00348642 predicted 448
10 SASI_Hs02_00348643 predicted 1058
11 SASI_Hs01_00083921 predicted 1063
12 SASI_Hs01_00083924 predicted 549
13 SASI_Hs01_00083927 predicted 1138
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175757 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00096189 predicted 358
2 SASI_Rn01_00096190 predicted 707
3 SASI_Rn01_00096191 predicted 497
4 SASI_Rn01_00096192 predicted 280
5 SASI_Rn01_00096193 predicted 509
6 SASI_Rn01_00096194 predicted 633
7 SASI_Rn01_00096195 predicted 1065
8 SASI_Rn01_00096196 predicted 574
9 SASI_Rn01_00096198 predicted 926
10 SASI_Rn02_00269511 predicted 915
11 SASI_Rn01_00096197 predicted 564
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030004 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00336370 predicted 985
2 SASI_Mm01_00053840 predicted 312
3 SASI_Mm01_00053841 predicted 386
4 SASI_Mm01_00053843 predicted 367
5 SASI_Mm01_00053844 predicted 747
6 SASI_Mm02_00336371 predicted 982
7 SASI_Mm01_00053842 predicted 972
8 SASI_Mm01_00053845 predicted 468
9 SASI_Mm01_00053846 predicted 362
10 SASI_Mm02_00336372 predicted 417
11 SASI_Mm01_00053847 predicted 985
12 SASI_Mm01_00053848 predicted 317
13 SASI_Mm01_00053849 predicted 689
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015974
VALIDATED
CRYL1 MISSION shRNA Bacterial Glycerol Stock
crystallin, lambda 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000444155    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015974.2-1199s21c1
Sequence:CCGGGCCCGTCACTTTGGATCATAGCTCGAGCTATGATCCAAAGTGACGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419316    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015974.2-1087s21c1
Sequence:CCGGGGAACACTGCAAGCCCTTAATCTCGAGATTAAGGGCTTGCAGTGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015974.2-765s21c1
Sequence:CCGGGCATGCGGTATGCATTCATTGCTCGAGCAATGAATGCATACCGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015974.1-198s1c1
Sequence:CCGGCCAGGTGAAACTCTATGACATCTCGAGATGTCATAGAGTTTCACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015974.1-473s1c1
Sequence:CCGGCCACTTCTTGTCTCATGCCTTCTCGAGAAGGCATGAGACAAGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015974.1-834s1c1
Sequence:CCGGGCATCTCAATGCAGAAGGTATCTCGAGATACCTTCTGCATTGAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015974.1-699s1c1
Sequence:CCGGGCCTGCAATATGCAATCATCACTCGAGTGATGATTGCATATTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015974.1-343s1c1
Sequence:CCGGCCCAATATCCAAGAAGCAGTACTCGAGTACTGCTTCTTGGATATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015974
VALIDATED
CRYL1 MISSION shRNA shRNA Plasmid DNA
crystallin, lambda 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000444155    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015974.2-1199s21c1
Sequence:CCGGGCCCGTCACTTTGGATCATAGCTCGAGCTATGATCCAAAGTGACGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419316    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015974.2-1087s21c1
Sequence:CCGGGGAACACTGCAAGCCCTTAATCTCGAGATTAAGGGCTTGCAGTGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015974.2-765s21c1
Sequence:CCGGGCATGCGGTATGCATTCATTGCTCGAGCAATGAATGCATACCGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015974.1-198s1c1
Sequence:CCGGCCAGGTGAAACTCTATGACATCTCGAGATGTCATAGAGTTTCACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015974.1-473s1c1
Sequence:CCGGCCACTTCTTGTCTCATGCCTTCTCGAGAAGGCATGAGACAAGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015974.1-834s1c1
Sequence:CCGGGCATCTCAATGCAGAAGGTATCTCGAGATACCTTCTGCATTGAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015974.1-699s1c1
Sequence:CCGGGCCTGCAATATGCAATCATCACTCGAGTGATGATTGCATATTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015974.1-343s1c1
Sequence:CCGGCCCAATATCCAAGAAGCAGTACTCGAGTACTGCTTCTTGGATATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015974
VALIDATED
CRYL1 MISSION shRNA Lentiviral Transduction Particles
crystallin, lambda 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000444155    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015974.2-1199s21c1
Sequence:CCGGGCCCGTCACTTTGGATCATAGCTCGAGCTATGATCCAAAGTGACGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419316    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015974.2-1087s21c1
Sequence:CCGGGGAACACTGCAAGCCCTTAATCTCGAGATTAAGGGCTTGCAGTGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015974.2-765s21c1
Sequence:CCGGGCATGCGGTATGCATTCATTGCTCGAGCAATGAATGCATACCGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015974.1-198s1c1
Sequence:CCGGCCAGGTGAAACTCTATGACATCTCGAGATGTCATAGAGTTTCACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015974.1-473s1c1
Sequence:CCGGCCACTTCTTGTCTCATGCCTTCTCGAGAAGGCATGAGACAAGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015974.1-834s1c1
Sequence:CCGGGCATCTCAATGCAGAAGGTATCTCGAGATACCTTCTGCATTGAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015974.1-699s1c1
Sequence:CCGGGCCTGCAATATGCAATCATCACTCGAGTGATGATTGCATATTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015974.1-343s1c1
Sequence:CCGGCCCAATATCCAAGAAGCAGTACTCGAGTACTGCTTCTTGGATATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030004
CRYL1 MISSION shRNA Bacterial Glycerol Stock
crystallin, lambda 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098480    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030004.2-1266s1c1
Sequence:CCGGCCAGTGTGATTACACGTGCATCTCGAGATGCACGTGTAATCACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030004.2-471s1c1
Sequence:CCGGCCTGTCAATCCACCATATTATCTCGAGATAATATGGTGGATTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030004.2-321s1c1
Sequence:CCGGCCAGAGAACCTAGAACTGAAACTCGAGTTTCAGTTCTAGGTTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030004.2-467s1c1
Sequence:CCGGTCATCCTGTCAATCCACCATACTCGAGTATGGTGGATTGACAGGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030004.2-441s1c1
Sequence:CCGGGCTCATGTGAAGCAGTGCATTCTCGAGAATGCACTGCTTCACATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030004
CRYL1 MISSION shRNA shRNA Plasmid DNA
crystallin, lambda 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098480    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030004.2-1266s1c1
Sequence:CCGGCCAGTGTGATTACACGTGCATCTCGAGATGCACGTGTAATCACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030004.2-471s1c1
Sequence:CCGGCCTGTCAATCCACCATATTATCTCGAGATAATATGGTGGATTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030004.2-321s1c1
Sequence:CCGGCCAGAGAACCTAGAACTGAAACTCGAGTTTCAGTTCTAGGTTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030004.2-467s1c1
Sequence:CCGGTCATCCTGTCAATCCACCATACTCGAGTATGGTGGATTGACAGGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030004.2-441s1c1
Sequence:CCGGGCTCATGTGAAGCAGTGCATTCTCGAGAATGCACTGCTTCACATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030004
CRYL1 MISSION shRNA Lentiviral Transduction Particles
crystallin, lambda 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098480    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030004.2-1266s1c1
Sequence:CCGGCCAGTGTGATTACACGTGCATCTCGAGATGCACGTGTAATCACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030004.2-471s1c1
Sequence:CCGGCCTGTCAATCCACCATATTATCTCGAGATAATATGGTGGATTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030004.2-321s1c1
Sequence:CCGGCCAGAGAACCTAGAACTGAAACTCGAGTTTCAGTTCTAGGTTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030004.2-467s1c1
Sequence:CCGGTCATCCTGTCAATCCACCATACTCGAGTATGGTGGATTGACAGGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030004.2-441s1c1
Sequence:CCGGGCTCATGTGAAGCAGTGCATTCTCGAGAATGCACTGCTTCACATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks