EMAIL THIS PAGE TO A FRIEND

CRYM-AS1

CRYM antisense RNA 1

33 Gene Product Result for
Synonyms: NCRNA00169
Species: Human CRYM-AS1(400508)
UniProtKB ID: A6NIL9, B3KVZ2
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001101368 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001101368 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001101368 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU003651 MISSION® esiRNA esiRNA targeting human NCRNA00169 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001101368 Rosetta Predictions human pricing
XM_375307 Rosetta Predictions human pricing
XM_933502 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001101368 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322715 predicted 636
2 SASI_Hs02_00322716 predicted 577
3 SASI_Hs02_00322717 predicted 693
4 SASI_Hs02_00322718 predicted 694
5 SASI_Hs02_00322719 predicted 703
6 SASI_Hs02_00322720 predicted 707
7 SASI_Hs02_00322721 predicted 602
8 SASI_Hs02_00322722 predicted 716
9 SASI_Hs02_00322723 predicted 779
10 SASI_Hs02_00322724 predicted 705
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_375307 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00294600 predicted 618
2 SASI_Hs01_00294601 predicted 586
3 SASI_Hs01_00294602 predicted 511
4 SASI_Hs01_00294603 predicted 540
5 SASI_Hs01_00294604 predicted 667
6 SASI_Hs01_00294605 predicted 366
7 SASI_Hs01_00294606 predicted 548
8 SASI_Hs01_00294607 predicted 418
9 SASI_Hs01_00294608 predicted 304
10 SASI_Hs01_00294609 predicted 433
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933502 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00300234 predicted 777
2 SASI_Hs01_00300235 predicted 778
3 SASI_Hs01_00300236 predicted 896
4 SASI_Hs01_00300237 predicted 868
5 SASI_Hs01_00300238 predicted 793
6 SASI_Hs01_00300239 predicted 815
7 SASI_Hs01_00300240 predicted 941
8 SASI_Hs01_00300241 predicted 648
9 SASI_Hs01_00300242 predicted 820
10 SASI_Hs01_00300243 predicted 693
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001101368
CRYM-AS1 MISSION shRNA Bacterial Glycerol Stock
CRYM antisense RNA 1
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000271637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101368.1-828s21c1
Sequence:CCGGCTCAAATGAAAGGTTAGAAATCTCGAGATTTCTAACCTTTCATTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101368.1-646s21c1
Sequence:CCGGACGCTCTGTTATTACTATAAACTCGAGTTTATAGTAATAACAGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101368.1-781s21c1
Sequence:CCGGTACTGTGGTTCAGGGTATTATCTCGAGATAATACCCTGAACCACAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271590    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101368.1-951s21c1
Sequence:CCGGGGAATCCTCATACTAAGTATACTCGAGTATACTTAGTATGAGGATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001101368
CRYM-AS1 MISSION shRNA shRNA Plasmid DNA
CRYM antisense RNA 1
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000271637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101368.1-828s21c1
Sequence:CCGGCTCAAATGAAAGGTTAGAAATCTCGAGATTTCTAACCTTTCATTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101368.1-646s21c1
Sequence:CCGGACGCTCTGTTATTACTATAAACTCGAGTTTATAGTAATAACAGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101368.1-781s21c1
Sequence:CCGGTACTGTGGTTCAGGGTATTATCTCGAGATAATACCCTGAACCACAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271590    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101368.1-951s21c1
Sequence:CCGGGGAATCCTCATACTAAGTATACTCGAGTATACTTAGTATGAGGATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001101368
CRYM-AS1 MISSION shRNA Lentiviral Transduction Particles
CRYM antisense RNA 1
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000271637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101368.1-828s21c1
Sequence:CCGGCTCAAATGAAAGGTTAGAAATCTCGAGATTTCTAACCTTTCATTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101368.1-646s21c1
Sequence:CCGGACGCTCTGTTATTACTATAAACTCGAGTTTATAGTAATAACAGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101368.1-781s21c1
Sequence:CCGGTACTGTGGTTCAGGGTATTATCTCGAGATAATACCCTGAACCACAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271590    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101368.1-951s21c1
Sequence:CCGGGGAATCCTCATACTAAGTATACTCGAGTATACTTAGTATGAGGATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks