EMAIL THIS PAGE TO A FRIEND

CRYM

crystallin, mu

Synonyms: DFNA40 THBP
UniProtKB ID: Q14894, D5MNX0, Q5HYB7
Gene ID:
Human(1428) Summary: Crystallins are separated into two classes: taxon-specific and ubiquitous. The former class is also called phylogenetically-restricted crystallins. The latter class constitutes the major proteins of vertebrate eye lens and maintains the transparency and refractive index of the lens. This gene encodes a taxon-specific crystallin protein that binds NADPH and has sequence similarity to bacterial ornithine cyclodeaminases. The encoded protein does not perform a structural role in lens tissue, and instead it binds thyroid hormone for possible regulatory or developmental roles. Mutations in this gene have been associated with autosomal dominant non-syndromic deafness. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2010]
Mouse(12971) crystallin, mu
Rat(117024) crystallin, mu
Goat(100861024) crystallin, mu
sheep(101102280) crystallin, mu
naked mole-rat(101706899) crystallin, mu
Zebrafish(791205) crystallin, mu
dog(479818) crystallin, mu
cow(505167) crystallin, mu
domestic cat(101080756) crystallin, mu
chicken(427008) crystallin, mu
68 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016669 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016669 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016669 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001888 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001888 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001888 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001014444 Rosetta Predictions human pricing
NM_001888 Rosetta Predictions human pricing
NM_053955 Rosetta Predictions rat pricing
NM_016669 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014444 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061160 predicted 495
2 SASI_Hs01_00061161 predicted 893
3 SASI_Hs02_00306549 predicted 938
4 SASI_Hs01_00061162 predicted 515
5 SASI_Hs01_00061163 predicted 958
6 SASI_Hs01_00061164 predicted 886
7 SASI_Hs01_00061166 predicted 319
8 SASI_Hs01_00061167 predicted 526
9 SASI_Hs01_00061168 predicted 978
10 SASI_Hs01_00061169 predicted 410
11 SASI_Hs01_00061165 predicted 931
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001888 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00168880 predicted 543
2 SASI_Hs01_00168881 predicted 948
3 SASI_Hs02_00332750 predicted 982
4 SASI_Hs01_00168882 predicted 558
5 SASI_Hs01_00168883 predicted 998
6 SASI_Hs01_00168884 predicted 933
7 SASI_Hs01_00168886 predicted 364
8 SASI_Hs01_00168887 predicted 575
9 SASI_Hs01_00168888 predicted 1027
10 SASI_Hs01_00168889 predicted 456
11 SASI_Hs01_00168885 predicted 981
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053955 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00039835 predicted 517
2 SASI_Rn01_00039836 predicted 603
3 SASI_Rn01_00039837 predicted 247
4 SASI_Rn01_00039838 predicted 616
5 SASI_Rn01_00039839 predicted 427
6 SASI_Rn01_00039840 predicted 461
7 SASI_Rn01_00039841 predicted 347
8 SASI_Rn01_00039842 predicted 504
9 SASI_Rn01_00039843 predicted 707
10 SASI_Rn01_00039844 predicted 934
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016669 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00323290 predicted 530
2 SASI_Mm02_00323291 predicted 541
3 SASI_Mm02_00323292 predicted 430
4 SASI_Mm02_00323293 predicted 275
5 SASI_Mm02_00323294 predicted 379
6 SASI_Mm02_00323295 predicted 955
7 SASI_Mm02_00323296 predicted 872
8 SASI_Mm02_00323297 predicted 953
9 SASI_Mm02_00323298 predicted 904
10 SASI_Mm02_00323299 predicted 906
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016669
CRYM MISSION shRNA Bacterial Glycerol Stock
crystallin, mu
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120147    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016669.1-1032s1c1
Sequence:CCGGCCATCACAGCTCAACACTGTTCTCGAGAACAGTGTTGAGCTGTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016669.1-341s1c1
Sequence:CCGGGCATCGGTGCTTCTCTTTGATCTCGAGATCAAAGAGAAGCACCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016669.1-962s1c1
Sequence:CCGGGTTGCAGCCAAATTAGTATATCTCGAGATATACTAATTTGGCTGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016669.1-284s1c1
Sequence:CCGGACCAAGTTAGTCACCTTCTATCTCGAGATAGAAGGTGACTAACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016669.1-965s1c1
Sequence:CCGGGCAGCCAAATTAGTATATGATCTCGAGATCATATACTAATTTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016669
CRYM MISSION shRNA shRNA Plasmid DNA
crystallin, mu
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120147    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016669.1-1032s1c1
Sequence:CCGGCCATCACAGCTCAACACTGTTCTCGAGAACAGTGTTGAGCTGTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016669.1-341s1c1
Sequence:CCGGGCATCGGTGCTTCTCTTTGATCTCGAGATCAAAGAGAAGCACCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016669.1-962s1c1
Sequence:CCGGGTTGCAGCCAAATTAGTATATCTCGAGATATACTAATTTGGCTGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016669.1-284s1c1
Sequence:CCGGACCAAGTTAGTCACCTTCTATCTCGAGATAGAAGGTGACTAACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016669.1-965s1c1
Sequence:CCGGGCAGCCAAATTAGTATATGATCTCGAGATCATATACTAATTTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016669
CRYM MISSION shRNA Lentiviral Transduction Particles
crystallin, mu
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120147    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016669.1-1032s1c1
Sequence:CCGGCCATCACAGCTCAACACTGTTCTCGAGAACAGTGTTGAGCTGTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016669.1-341s1c1
Sequence:CCGGGCATCGGTGCTTCTCTTTGATCTCGAGATCAAAGAGAAGCACCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016669.1-962s1c1
Sequence:CCGGGTTGCAGCCAAATTAGTATATCTCGAGATATACTAATTTGGCTGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016669.1-284s1c1
Sequence:CCGGACCAAGTTAGTCACCTTCTATCTCGAGATAGAAGGTGACTAACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016669.1-965s1c1
Sequence:CCGGGCAGCCAAATTAGTATATGATCTCGAGATCATATACTAATTTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001888
VALIDATED
CRYM MISSION shRNA Bacterial Glycerol Stock
crystallin, mu
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_001888.1-736s1c1
Sequence:CCGGCTGGATGATGAGCTCATGAAACTCGAGTTTCATGAGCTCATCATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001888.1-944s1c1
Sequence:CCGGTCATCTATGATTCCTGGTCATCTCGAGATGACCAGGAATCATAGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001888.1-893s1c1
Sequence:CCGGCGGTGTTCAAGTCTTTGGGAACTCGAGTTCCCAAAGACTTGAACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001888.1-319s1c1
Sequence:CCGGCTACTCTTTGAGCCCAGCAATCTCGAGATTGCTGGGCTCAAAGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001888.2-580s21c1
Sequence:CCGGGATATGGAACCGCACCAAAGACTCGAGTCTTTGGTGCGGTTCCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416141    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001888.2-1036s21c1
Sequence:CCGGAGGAACTTGATGTTGAGATGGCTCGAGCCATCTCAACATCAAGTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001888.2-419s21c1
Sequence:CCGGGGAAATGTCATAACTGCAAAGCTCGAGCTTTGCAGTTATGACATTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418351    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001888.2-1072s21c1
Sequence:CCGGTGCTGCTGGTTCTCATAATTTCTCGAGAAATTATGAGAACCAGCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001888.2-363s21c1
Sequence:CCGGAGGCTACTGTGCTACTCTTTGCTCGAGCAAAGAGTAGCACAGTAGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001888.2-905s21c1
Sequence:CCGGGAAGTGATTAAGGGAGTGAAACTCGAGTTTCACTCCCTTAATCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001888.2-944s21c1
Sequence:CCCGACCACCGTGTTCAAGTCTTTGCTCGAGCAAAGACTTGAACACGGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001888
VALIDATED
CRYM MISSION shRNA shRNA Plasmid DNA
crystallin, mu
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_001888.1-736s1c1
Sequence:CCGGCTGGATGATGAGCTCATGAAACTCGAGTTTCATGAGCTCATCATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001888.1-944s1c1
Sequence:CCGGTCATCTATGATTCCTGGTCATCTCGAGATGACCAGGAATCATAGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001888.1-893s1c1
Sequence:CCGGCGGTGTTCAAGTCTTTGGGAACTCGAGTTCCCAAAGACTTGAACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001888.1-319s1c1
Sequence:CCGGCTACTCTTTGAGCCCAGCAATCTCGAGATTGCTGGGCTCAAAGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001888.2-580s21c1
Sequence:CCGGGATATGGAACCGCACCAAAGACTCGAGTCTTTGGTGCGGTTCCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416141    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001888.2-1036s21c1
Sequence:CCGGAGGAACTTGATGTTGAGATGGCTCGAGCCATCTCAACATCAAGTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001888.2-419s21c1
Sequence:CCGGGGAAATGTCATAACTGCAAAGCTCGAGCTTTGCAGTTATGACATTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418351    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001888.2-1072s21c1
Sequence:CCGGTGCTGCTGGTTCTCATAATTTCTCGAGAAATTATGAGAACCAGCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001888.2-363s21c1
Sequence:CCGGAGGCTACTGTGCTACTCTTTGCTCGAGCAAAGAGTAGCACAGTAGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001888.2-905s21c1
Sequence:CCGGGAAGTGATTAAGGGAGTGAAACTCGAGTTTCACTCCCTTAATCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001888.2-944s21c1
Sequence:CCCGACCACCGTGTTCAAGTCTTTGCTCGAGCAAAGACTTGAACACGGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001888
VALIDATED
CRYM MISSION shRNA Lentiviral Transduction Particles
crystallin, mu
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_001888.1-736s1c1
Sequence:CCGGCTGGATGATGAGCTCATGAAACTCGAGTTTCATGAGCTCATCATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001888.1-944s1c1
Sequence:CCGGTCATCTATGATTCCTGGTCATCTCGAGATGACCAGGAATCATAGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001888.1-893s1c1
Sequence:CCGGCGGTGTTCAAGTCTTTGGGAACTCGAGTTCCCAAAGACTTGAACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001888.1-319s1c1
Sequence:CCGGCTACTCTTTGAGCCCAGCAATCTCGAGATTGCTGGGCTCAAAGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001888.2-580s21c1
Sequence:CCGGGATATGGAACCGCACCAAAGACTCGAGTCTTTGGTGCGGTTCCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416141    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001888.2-1036s21c1
Sequence:CCGGAGGAACTTGATGTTGAGATGGCTCGAGCCATCTCAACATCAAGTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001888.2-419s21c1
Sequence:CCGGGGAAATGTCATAACTGCAAAGCTCGAGCTTTGCAGTTATGACATTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418351    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001888.2-1072s21c1
Sequence:CCGGTGCTGCTGGTTCTCATAATTTCTCGAGAAATTATGAGAACCAGCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001888.2-363s21c1
Sequence:CCGGAGGCTACTGTGCTACTCTTTGCTCGAGCAAAGAGTAGCACAGTAGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001888.2-905s21c1
Sequence:CCGGGAAGTGATTAAGGGAGTGAAACTCGAGTTTCACTCCCTTAATCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001888.2-944s21c1
Sequence:CCCGACCACCGTGTTCAAGTCTTTGCTCGAGCAAAGACTTGAACACGGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks