EMAIL THIS PAGE TO A FRIEND

CRYZ

crystallin, zeta (quinone reductase)

Gene ID:
Human(1429) Summary: Crystallins are separated into two classes: taxon-specific, or enzyme, and ubiquitous. The latter class constitutes the major proteins of vertebrate eye lens and maintains the transparency and refractive index of the lens. The former class is also called phylogenetically-restricted crystallins. This gene encodes a taxon-specific crystallin protein which has NADPH-dependent quinone reductase activity distinct from other known quinone reductases. It lacks alcohol dehydrogenase activity although by similarity it is considered a member of the zinc-containing alcohol dehydrogenase family. Unlike other mammalian species, in humans, lens expression is low. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. One pseudogene is known to exist. [provided by RefSeq, Sep 2008]
Mouse(12972) crystallin, zeta
Rat(362061) crystallin, zeta (quinone reductase)
Zebrafish(407640) crystallin, zeta (quinone reductase)
chicken(772289) crystallin, zeta (quinone reductase)
dog(611431) crystallin, zeta (quinone reductase)
cow(281093) crystallin, zeta (quinone reductase)
domestic cat(101086075) crystallin, zeta (quinone reductase)
naked mole-rat(101712564) crystallin, zeta (quinone reductase)
71 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009968 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009968 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009968 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001889 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001889 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001889 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001889 Rosetta Predictions human pricing
NM_001012183 Rosetta Predictions rat pricing
XM_575066 Rosetta Predictions rat pricing
NM_009968 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001889 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234022 predicted 764
2 SASI_Hs01_00234023 predicted 826
3 SASI_Hs01_00234024 predicted 1138
4 SASI_Hs01_00234025 predicted 740
5 SASI_Hs01_00234027 predicted 1173
6 SASI_Hs01_00234030 predicted 878
7 SASI_Hs02_00332751 predicted 677
8 SASI_Hs01_00234021 predicted 732
9 SASI_Hs02_00332752 predicted 1096
10 SASI_Hs02_00332753 predicted 1178
11 SASI_Hs01_00234026 predicted 1080
12 SASI_Hs01_00234028 predicted 1106
13 SASI_Hs01_00234029 predicted 931
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012183 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00058278 predicted 578
2 SASI_Rn01_00058279 predicted 650
3 SASI_Rn02_00200388 predicted 957
4 SASI_Rn01_00058280 predicted 850
5 SASI_Rn01_00058281 predicted 948
6 SASI_Rn01_00058282 predicted 802
7 SASI_Rn01_00058283 predicted 806
8 SASI_Rn01_00058284 predicted 293
9 SASI_Rn01_00058285 predicted 712
10 SASI_Rn01_00058286 predicted 862
11 SASI_Rn01_00058287 predicted 754
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575066 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00125271 predicted 577
2 SASI_Rn01_00125272 predicted 651
3 SASI_Rn01_00125273 predicted 849
4 SASI_Rn01_00125274 predicted 952
5 SASI_Rn01_00125275 predicted 801
6 SASI_Rn01_00125276 predicted 817
7 SASI_Rn01_00125277 predicted 297
8 SASI_Rn01_00125278 predicted 719
9 SASI_Rn01_00125279 predicted 864
10 SASI_Rn01_00125280 predicted 752
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009968 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00317532 predicted 311
2 SASI_Mm01_00169755 predicted 1177
3 SASI_Mm01_00169756 predicted 883
4 SASI_Mm01_00169757 predicted 1174
5 SASI_Mm02_00317533 predicted 964
6 SASI_Mm01_00169760 predicted 1342
7 SASI_Mm02_00317534 predicted 298
8 SASI_Mm02_00317535 predicted 295
9 SASI_Mm01_00169761 predicted 1264
10 SASI_Mm02_00317536 predicted 975
11 SASI_Mm01_00169758 predicted 347
12 SASI_Mm01_00169759 predicted 1394
13 SASI_Mm01_00169762 predicted 1191
14 SASI_Mm01_00169763 predicted 1389
15 SASI_Mm01_00169764 predicted 994
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009968
VALIDATED
CRYZ MISSION shRNA Bacterial Glycerol Stock
crystallin, zeta (quinone reductase)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000324624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009968.2-1186s21c1
Sequence:CCGGGATAGGTTCTGAGTATCCATTCTCGAGAATGGATACTCAGAACCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324544    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009968.2-1574s21c1
Sequence:CCGGGCCGTCTAAATGCTGGGATAACTCGAGTTATCCCAGCATTTAGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009968.2-968s21c1
Sequence:CCGGGCGAATGAGAACCTTAGCAATCTCGAGATTGCTAAGGTTCTCATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009968.2-506s21c1
Sequence:CCGGGCTGGGATCATAGAATCCGTTCTCGAGAACGGATTCTATGATCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009968.1-994s1c1
Sequence:CCGGCCTGTGATAGGTTCTGAGTATCTCGAGATACTCAGAACCTATCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009968.1-319s1c1
Sequence:CCGGGCTGGGATCATAGAATCCGTTCTCGAGAACGGATTCTATGATCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009968.1-781s1c1
Sequence:CCGGGCGAATGAGAACCTTAGCAATCTCGAGATTGCTAAGGTTCTCATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009968.1-999s1c1
Sequence:CCGGGATAGGTTCTGAGTATCCATTCTCGAGAATGGATACTCAGAACCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098280    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009968.1-1387s1c1
Sequence:CCGGGCCGTCTAAATGCTGGGATAACTCGAGTTATCCCAGCATTTAGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009968
VALIDATED
CRYZ MISSION shRNA shRNA Plasmid DNA
crystallin, zeta (quinone reductase)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000324624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009968.2-1186s21c1
Sequence:CCGGGATAGGTTCTGAGTATCCATTCTCGAGAATGGATACTCAGAACCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324544    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009968.2-1574s21c1
Sequence:CCGGGCCGTCTAAATGCTGGGATAACTCGAGTTATCCCAGCATTTAGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009968.2-968s21c1
Sequence:CCGGGCGAATGAGAACCTTAGCAATCTCGAGATTGCTAAGGTTCTCATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009968.2-506s21c1
Sequence:CCGGGCTGGGATCATAGAATCCGTTCTCGAGAACGGATTCTATGATCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009968.1-994s1c1
Sequence:CCGGCCTGTGATAGGTTCTGAGTATCTCGAGATACTCAGAACCTATCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009968.1-319s1c1
Sequence:CCGGGCTGGGATCATAGAATCCGTTCTCGAGAACGGATTCTATGATCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009968.1-781s1c1
Sequence:CCGGGCGAATGAGAACCTTAGCAATCTCGAGATTGCTAAGGTTCTCATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009968.1-999s1c1
Sequence:CCGGGATAGGTTCTGAGTATCCATTCTCGAGAATGGATACTCAGAACCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098280    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009968.1-1387s1c1
Sequence:CCGGGCCGTCTAAATGCTGGGATAACTCGAGTTATCCCAGCATTTAGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009968
VALIDATED
CRYZ MISSION shRNA Lentiviral Transduction Particles
crystallin, zeta (quinone reductase)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000324624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009968.2-1186s21c1
Sequence:CCGGGATAGGTTCTGAGTATCCATTCTCGAGAATGGATACTCAGAACCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324544    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009968.2-1574s21c1
Sequence:CCGGGCCGTCTAAATGCTGGGATAACTCGAGTTATCCCAGCATTTAGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009968.2-968s21c1
Sequence:CCGGGCGAATGAGAACCTTAGCAATCTCGAGATTGCTAAGGTTCTCATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009968.2-506s21c1
Sequence:CCGGGCTGGGATCATAGAATCCGTTCTCGAGAACGGATTCTATGATCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009968.1-994s1c1
Sequence:CCGGCCTGTGATAGGTTCTGAGTATCTCGAGATACTCAGAACCTATCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009968.1-319s1c1
Sequence:CCGGGCTGGGATCATAGAATCCGTTCTCGAGAACGGATTCTATGATCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009968.1-781s1c1
Sequence:CCGGGCGAATGAGAACCTTAGCAATCTCGAGATTGCTAAGGTTCTCATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009968.1-999s1c1
Sequence:CCGGGATAGGTTCTGAGTATCCATTCTCGAGAATGGATACTCAGAACCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098280    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009968.1-1387s1c1
Sequence:CCGGGCCGTCTAAATGCTGGGATAACTCGAGTTATCCCAGCATTTAGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001889
VALIDATED
CRYZ MISSION shRNA Bacterial Glycerol Stock
crystallin, zeta (quinone reductase)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000300207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001889.3-1052s21c1
Sequence:CCGGGAAGTGTTCAATCACAGAGAACTCGAGTTCTCTGTGATTGAACACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001889.3-1355s21c1
Sequence:CCGGCCTGTGATAGGTTCTCAATATCTCGAGATATTGAGAACCTATCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001889.3-1290s21c1
Sequence:CCGGCCAAGGAGGAATTTCAGCAATCTCGAGATTGCTGAAATTCCTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001889.3-1209s21c1
Sequence:CCGGGCAGAGGTACTATTGAAATAACTCGAGTTATTTCAATAGTACCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001889.2-844s1c1
Sequence:CCGGGCAGAGGTACTATTGAAATAACTCGAGTTATTTCAATAGTACCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001889.2-925s1c1
Sequence:CCGGCCAAGGAGGAATTTCAGCAATCTCGAGATTGCTGAAATTCCTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001889.2-990s1c1
Sequence:CCGGCCTGTGATAGGTTCTCAATATCTCGAGATATTGAGAACCTATCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001889.2-789s1c1
Sequence:CCGGCTTAGTAAAGACTTGAGTCTTCTCGAGAAGACTCAAGTCTTTACTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001889.2-687s1c1
Sequence:CCGGGAAGTGTTCAATCACAGAGAACTCGAGTTCTCTGTGATTGAACACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001889
VALIDATED
CRYZ MISSION shRNA shRNA Plasmid DNA
crystallin, zeta (quinone reductase)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000300207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001889.3-1052s21c1
Sequence:CCGGGAAGTGTTCAATCACAGAGAACTCGAGTTCTCTGTGATTGAACACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001889.3-1355s21c1
Sequence:CCGGCCTGTGATAGGTTCTCAATATCTCGAGATATTGAGAACCTATCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001889.3-1290s21c1
Sequence:CCGGCCAAGGAGGAATTTCAGCAATCTCGAGATTGCTGAAATTCCTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001889.3-1209s21c1
Sequence:CCGGGCAGAGGTACTATTGAAATAACTCGAGTTATTTCAATAGTACCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001889.2-844s1c1
Sequence:CCGGGCAGAGGTACTATTGAAATAACTCGAGTTATTTCAATAGTACCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001889.2-925s1c1
Sequence:CCGGCCAAGGAGGAATTTCAGCAATCTCGAGATTGCTGAAATTCCTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001889.2-990s1c1
Sequence:CCGGCCTGTGATAGGTTCTCAATATCTCGAGATATTGAGAACCTATCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001889.2-789s1c1
Sequence:CCGGCTTAGTAAAGACTTGAGTCTTCTCGAGAAGACTCAAGTCTTTACTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001889.2-687s1c1
Sequence:CCGGGAAGTGTTCAATCACAGAGAACTCGAGTTCTCTGTGATTGAACACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001889
VALIDATED
CRYZ MISSION shRNA Lentiviral Transduction Particles
crystallin, zeta (quinone reductase)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000300207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001889.3-1052s21c1
Sequence:CCGGGAAGTGTTCAATCACAGAGAACTCGAGTTCTCTGTGATTGAACACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001889.3-1355s21c1
Sequence:CCGGCCTGTGATAGGTTCTCAATATCTCGAGATATTGAGAACCTATCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001889.3-1290s21c1
Sequence:CCGGCCAAGGAGGAATTTCAGCAATCTCGAGATTGCTGAAATTCCTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001889.3-1209s21c1
Sequence:CCGGGCAGAGGTACTATTGAAATAACTCGAGTTATTTCAATAGTACCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001889.2-844s1c1
Sequence:CCGGGCAGAGGTACTATTGAAATAACTCGAGTTATTTCAATAGTACCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001889.2-925s1c1
Sequence:CCGGCCAAGGAGGAATTTCAGCAATCTCGAGATTGCTGAAATTCCTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001889.2-990s1c1
Sequence:CCGGCCTGTGATAGGTTCTCAATATCTCGAGATATTGAGAACCTATCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001889.2-789s1c1
Sequence:CCGGCTTAGTAAAGACTTGAGTCTTCTCGAGAAGACTCAAGTCTTTACTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001889.2-687s1c1
Sequence:CCGGGAAGTGTTCAATCACAGAGAACTCGAGTTCTCTGTGATTGAACACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks