EMAIL THIS PAGE TO A FRIEND

CRYZL1

crystallin, zeta (quinone reductase)-like 1

Synonyms: 4P11 QOH-1
UniProtKB ID: O95825, B2RDX1, Q96DY0, Q9NVY7
Gene ID:
Human(9946) Summary: This gene encodes a protein that has sequence similarity to zeta crystallin, also known as quinone oxidoreductase. This zeta crystallin-like protein also contains an NAD(P)H binding site. Alternatively spliced transcript variants have been observed but their full-length nature has not been completely determined. [provided by RefSeq, Jul 2008]
Mouse(66609) crystallin, zeta (quinone reductase)-like 1
Rat(288256) crystallin, zeta (quinone reductase)-like 1
sheep(101121053) crystallin, zeta (quinone reductase)-like 1
Domestic Rabbit(100328813) crystallin, zeta (quinone reductase)-like 1
naked mole-rat(101699170) crystallin, zeta (quinone reductase)-like 1
domestic guinea pig(100728850) crystallin, zeta (quinone reductase)-like 1
Zebrafish(436906) crystallin, zeta (quinone reductase)-like 1
cow(506426) crystallin, zeta (quinone reductase)-like 1
domestic cat(101086834) crystallin, zeta (quinone reductase)-like 1
dog(478408) crystallin, zeta (quinone reductase)-like 1
chicken(418505) crystallin, zeta (quinone reductase)-like 1
61 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005111 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005111 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005111 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133679 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133679 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133679 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_145858 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145858 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145858 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU048871 MISSION® esiRNA esiRNA targeting mouse Cryzl1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145858 Rosetta Predictions human pricing
NM_001013044 Rosetta Predictions rat pricing
NM_133679 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145858 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00042492 predicted 640
2 SASI_Hs01_00042493 predicted 249
3 SASI_Hs01_00042494 predicted 838
4 SASI_Hs01_00042496 predicted 365
5 SASI_Hs02_00365384 predicted 1016
6 SASI_Hs01_00042497 predicted 1086
7 SASI_Hs01_00042498 predicted 671
8 SASI_Hs01_00042499 predicted 566
9 SASI_Hs01_00042500 predicted 497
10 SASI_Hs01_00042501 predicted 465
11 SASI_Hs01_00042495 predicted 404
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013044 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00062243 predicted 1006
2 SASI_Rn01_00062244 predicted 772
3 SASI_Rn01_00062245 predicted 635
4 SASI_Rn01_00062246 predicted 727
5 SASI_Rn01_00062247 predicted 582
6 SASI_Rn01_00062248 predicted 497
7 SASI_Rn01_00062249 predicted 958
8 SASI_Rn01_00062250 predicted 504
9 SASI_Rn01_00062251 predicted 683
10 SASI_Rn02_00200641 predicted 692
11 SASI_Rn01_00062252 predicted 872
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133679 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00045997 predicted 446
2 SASI_Mm01_00045999 predicted 611
3 SASI_Mm01_00046000 predicted 628
4 SASI_Mm01_00046001 predicted 662
5 SASI_Mm01_00046002 predicted 511
6 SASI_Mm01_00046003 predicted 656
7 SASI_Mm01_00046004 predicted 469
8 SASI_Mm01_00046005 predicted 694
9 SASI_Mm01_00046006 predicted 478
10 SASI_Mm02_00338639 predicted 789
11 SASI_Mm01_00045998 predicted 1150
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005111
VALIDATED
CRYZL1 MISSION shRNA Bacterial Glycerol Stock
crystallin, zeta (quinone reductase)-like 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_005111.5-663s1c1
Sequence:CCGGCCCGAGTGATTGATGTATCTACTCGAGTAGATACATCAATCACTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_005111.5-545s1c1
Sequence:CCGGGCAAGTGCATTTGGTACAATACTCGAGTATTGTACCAAATGCACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_005111.5-1037s1c1
Sequence:CCGGCCTCAGTTGGATGAACCCATTCTCGAGAATGGGTTCATCCAACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_005111.5-114s1c1
Sequence:CCGGCCACAGATGAAGAAATAACATCTCGAGATGTTATTTCTTCATCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_005111.5-488s1c1
Sequence:CCGGGCTCTGCATTATCTTTCTCATCTCGAGATGAGAAAGATAATGCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005111
VALIDATED
CRYZL1 MISSION shRNA shRNA Plasmid DNA
crystallin, zeta (quinone reductase)-like 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_005111.5-663s1c1
Sequence:CCGGCCCGAGTGATTGATGTATCTACTCGAGTAGATACATCAATCACTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_005111.5-545s1c1
Sequence:CCGGGCAAGTGCATTTGGTACAATACTCGAGTATTGTACCAAATGCACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_005111.5-1037s1c1
Sequence:CCGGCCTCAGTTGGATGAACCCATTCTCGAGAATGGGTTCATCCAACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_005111.5-114s1c1
Sequence:CCGGCCACAGATGAAGAAATAACATCTCGAGATGTTATTTCTTCATCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_005111.5-488s1c1
Sequence:CCGGGCTCTGCATTATCTTTCTCATCTCGAGATGAGAAAGATAATGCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005111
VALIDATED
CRYZL1 MISSION shRNA Lentiviral Transduction Particles
crystallin, zeta (quinone reductase)-like 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_005111.5-663s1c1
Sequence:CCGGCCCGAGTGATTGATGTATCTACTCGAGTAGATACATCAATCACTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_005111.5-545s1c1
Sequence:CCGGGCAAGTGCATTTGGTACAATACTCGAGTATTGTACCAAATGCACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_005111.5-1037s1c1
Sequence:CCGGCCTCAGTTGGATGAACCCATTCTCGAGAATGGGTTCATCCAACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_005111.5-114s1c1
Sequence:CCGGCCACAGATGAAGAAATAACATCTCGAGATGTTATTTCTTCATCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_005111.5-488s1c1
Sequence:CCGGGCTCTGCATTATCTTTCTCATCTCGAGATGAGAAAGATAATGCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133679
VALIDATED
CRYZL1 MISSION shRNA Bacterial Glycerol Stock
crystallin, zeta (quinone reductase)-like 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133679.1-124s1c1
Sequence:CCGGCCTGTCACAGAGGATAACTTTCTCGAGAAAGTTATCCTCTGTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133679.1-1018s1c1
Sequence:CCGGCCACTGTATGAGGCAAAGGTTCTCGAGAACCTTTGCCTCATACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133679.1-451s1c1
Sequence:CCGGGCTCTGTATTATCTTTCTCAACTCGAGTTGAGAAAGATAATACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_133679.1-626s1c1
Sequence:CCGGCCCGTGTGATTGATGTGTCTACTCGAGTAGACACATCAATCACACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042123    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133679.1-1220s1c1
Sequence:CCGGCCACAGTAAGATGTTTGGTTACTCGAGTAACCAAACATCTTACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133679.1-688s21c1
Sequence:CCGGGGTGGCCTGGGAGTAGATATTCTCGAGAATATCTACTCCCAGGCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313428    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133679.1-1223s21c1
Sequence:CCGGCAGTAAGATGTTTGGTTATTTCTCGAGAAATAACCAAACATCTTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133679.1-626s21c1
Sequence:CCGGCCCGTGTGATTGATGTGTCTACTCGAGTAGACACATCAATCACACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133679.1-451s21c1
Sequence:CCGGGCTCTGTATTATCTTTCTCAACTCGAGTTGAGAAAGATAATACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133679.1-367s21c1
Sequence:CCGGGAGCATTACCTGGTTCATAAGCTCGAGCTTATGAACCAGGTAATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133679
VALIDATED
CRYZL1 MISSION shRNA shRNA Plasmid DNA
crystallin, zeta (quinone reductase)-like 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133679.1-124s1c1
Sequence:CCGGCCTGTCACAGAGGATAACTTTCTCGAGAAAGTTATCCTCTGTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133679.1-1018s1c1
Sequence:CCGGCCACTGTATGAGGCAAAGGTTCTCGAGAACCTTTGCCTCATACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133679.1-451s1c1
Sequence:CCGGGCTCTGTATTATCTTTCTCAACTCGAGTTGAGAAAGATAATACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_133679.1-626s1c1
Sequence:CCGGCCCGTGTGATTGATGTGTCTACTCGAGTAGACACATCAATCACACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042123    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133679.1-1220s1c1
Sequence:CCGGCCACAGTAAGATGTTTGGTTACTCGAGTAACCAAACATCTTACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133679.1-688s21c1
Sequence:CCGGGGTGGCCTGGGAGTAGATATTCTCGAGAATATCTACTCCCAGGCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313428    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133679.1-1223s21c1
Sequence:CCGGCAGTAAGATGTTTGGTTATTTCTCGAGAAATAACCAAACATCTTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133679.1-626s21c1
Sequence:CCGGCCCGTGTGATTGATGTGTCTACTCGAGTAGACACATCAATCACACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133679.1-451s21c1
Sequence:CCGGGCTCTGTATTATCTTTCTCAACTCGAGTTGAGAAAGATAATACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133679.1-367s21c1
Sequence:CCGGGAGCATTACCTGGTTCATAAGCTCGAGCTTATGAACCAGGTAATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133679
VALIDATED
CRYZL1 MISSION shRNA Lentiviral Transduction Particles
crystallin, zeta (quinone reductase)-like 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133679.1-124s1c1
Sequence:CCGGCCTGTCACAGAGGATAACTTTCTCGAGAAAGTTATCCTCTGTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133679.1-1018s1c1
Sequence:CCGGCCACTGTATGAGGCAAAGGTTCTCGAGAACCTTTGCCTCATACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133679.1-451s1c1
Sequence:CCGGGCTCTGTATTATCTTTCTCAACTCGAGTTGAGAAAGATAATACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_133679.1-626s1c1
Sequence:CCGGCCCGTGTGATTGATGTGTCTACTCGAGTAGACACATCAATCACACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042123    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133679.1-1220s1c1
Sequence:CCGGCCACAGTAAGATGTTTGGTTACTCGAGTAACCAAACATCTTACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133679.1-688s21c1
Sequence:CCGGGGTGGCCTGGGAGTAGATATTCTCGAGAATATCTACTCCCAGGCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313428    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133679.1-1223s21c1
Sequence:CCGGCAGTAAGATGTTTGGTTATTTCTCGAGAAATAACCAAACATCTTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133679.1-626s21c1
Sequence:CCGGCCCGTGTGATTGATGTGTCTACTCGAGTAGACACATCAATCACACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133679.1-451s21c1
Sequence:CCGGGCTCTGTATTATCTTTCTCAACTCGAGTTGAGAAAGATAATACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133679.1-367s21c1
Sequence:CCGGGAGCATTACCTGGTTCATAAGCTCGAGCTTATGAACCAGGTAATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145858
VALIDATED
CRYZL1 MISSION shRNA Bacterial Glycerol Stock
crystallin, zeta (quinone reductase)-like 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218738    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145858.2-1366s21c1
Sequence:GTACCGGAGATGCTCAGTTGACACATTTCTCGAGAAATGTGTCAACTGAGCATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_145858.2-894s21c1
Sequence:GTACCGGACTACAACTACTACCACATAACTCGAGTTATGTGGTAGTAGTTGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_145858.2-848s21c1
Sequence:CCGGATGCTGGAGTGAGATTATATACTCGAGTATATAATCTCACTCCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_145858.2-820s21c1
Sequence:CCGGGGTGGCCTGGGAGTAGATATTCTCGAGAATATCTACTCCCAGGCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_145858.2-499s21c1
Sequence:CCGGGAGCATTACTTGGTTCATAAACTCGAGTTTATGAACCAAGTAATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145858
VALIDATED
CRYZL1 MISSION shRNA shRNA Plasmid DNA
crystallin, zeta (quinone reductase)-like 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218738    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145858.2-1366s21c1
Sequence:GTACCGGAGATGCTCAGTTGACACATTTCTCGAGAAATGTGTCAACTGAGCATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_145858.2-894s21c1
Sequence:GTACCGGACTACAACTACTACCACATAACTCGAGTTATGTGGTAGTAGTTGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_145858.2-848s21c1
Sequence:CCGGATGCTGGAGTGAGATTATATACTCGAGTATATAATCTCACTCCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_145858.2-820s21c1
Sequence:CCGGGGTGGCCTGGGAGTAGATATTCTCGAGAATATCTACTCCCAGGCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_145858.2-499s21c1
Sequence:CCGGGAGCATTACTTGGTTCATAAACTCGAGTTTATGAACCAAGTAATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145858
VALIDATED
CRYZL1 MISSION shRNA Lentiviral Transduction Particles
crystallin, zeta (quinone reductase)-like 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218738    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145858.2-1366s21c1
Sequence:GTACCGGAGATGCTCAGTTGACACATTTCTCGAGAAATGTGTCAACTGAGCATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_145858.2-894s21c1
Sequence:GTACCGGACTACAACTACTACCACATAACTCGAGTTATGTGGTAGTAGTTGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_145858.2-848s21c1
Sequence:CCGGATGCTGGAGTGAGATTATATACTCGAGTATATAATCTCACTCCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_145858.2-820s21c1
Sequence:CCGGGGTGGCCTGGGAGTAGATATTCTCGAGAATATCTACTCCCAGGCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_145858.2-499s21c1
Sequence:CCGGGAGCATTACTTGGTTCATAAACTCGAGTTTATGAACCAAGTAATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks