EMAIL THIS PAGE TO A FRIEND

CS

citrate synthase

168 Gene Product Result for
UniProtKB ID: O75390, Q71UT9, Q7KZH0, Q96FZ8, Q9BWN8
Gene ID:
Human(1431) Summary: The protein encoded by this gene is a Krebs tricarboxylic acid cycle enzyme that catalyzes the synthesis of citrate from oxaloacetate and acetyl coenzyme A. The enzyme is found in nearly all cells capable of oxidative metablism. This protein is nuclear encoded and transported into the mitochondrial matrix, where the mature form is found. [provided by RefSeq, Jul 2008]
Mouse(12974) citrate synthase
Rat(170587) citrate synthase
sheep(101109163) citrate synthase
Domestic Rabbit(100327271) citrate synthase
naked mole-rat(101710152) citrate synthase
Zebrafish(322339) citrate synthase
chicken(100327410) Conformation score
chicken(100327409) Conformation score
chicken(100310550) Conformation score
chicken(100310549) Conformation score
cow(280682) citrate synthase
Horse(100052279) citrate synthase
domestic cat(751515) citrate synthase
dog(474403) citrate synthase
chicken(100858903) citrate synthase
chicken(100309934) Conformation score
chicken(100309924) Conformation score
chicken(100327599) Conformation score
chicken(100310552) Conformation score
chicken(100309917) Conformation score
chicken(100309916) Conformation score
chicken(100310659) Conformation score
chicken(100310091) Conformation score
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026444 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026444 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026444 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004077 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004077 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004077 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004077 Rosetta Predictions human pricing
NM_198324 Rosetta Predictions human pricing
NM_130755 Rosetta Predictions rat pricing
NM_026444 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004077 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211136 predicted 759
2 SASI_Hs02_00336871 predicted 751
3 SASI_Hs01_00211137 predicted 722
4 SASI_Hs01_00211139 predicted 1254
5 SASI_Hs01_00211141 predicted 787
6 SASI_Hs01_00211142 predicted 650
7 SASI_Hs01_00211143 predicted 1337
8 SASI_Hs02_00336872 predicted 783
9 SASI_Hs01_00211144 predicted 1564
10 SASI_Hs01_00211145 predicted 1367
11 SASI_Hs01_00211138 predicted 1153
12 SASI_Hs01_00211140 predicted 1556
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198324 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00157691 predicted 846
2 SASI_Hs02_00371876 predicted 828
3 SASI_Hs01_00157692 predicted 802
4 SASI_Hs01_00157694 predicted 1335
5 SASI_Hs01_00157696 predicted 868
6 SASI_Hs01_00157697 predicted 736
7 SASI_Hs01_00157698 predicted 1419
8 SASI_Hs02_00371877 predicted 867
9 SASI_Hs01_00157699 predicted 1640
10 SASI_Hs01_00157700 predicted 1445
11 SASI_Hs01_00157693 predicted 1236
12 SASI_Hs01_00157695 predicted 1644
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130755 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00094340 predicted 210
2 SASI_Rn01_00094341 predicted 636
3 SASI_Rn01_00094342 predicted 800
4 SASI_Rn01_00094343 predicted 835
5 SASI_Rn01_00094344 predicted 631
6 SASI_Rn01_00094345 predicted 1155
7 SASI_Rn01_00094346 predicted 872
8 SASI_Rn01_00094347 predicted 788
9 SASI_Rn01_00094348 predicted 618
10 SASI_Rn01_00094349 predicted 1095
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026444 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00162720 predicted 1564
2 SASI_Mm01_00162721 predicted 558
3 SASI_Mm01_00162722 predicted 981
4 SASI_Mm01_00162723 predicted 1035
5 SASI_Mm01_00162724 predicted 922
6 SASI_Mm01_00162726 predicted 1455
7 SASI_Mm01_00162725 predicted 227
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026444
VALIDATED
CS MISSION shRNA Bacterial Glycerol Stock
citrate synthase
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000324071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026444.3-1050s21c1
Sequence:CCGGGACGTGTCAGATGAGAAGTTACTCGAGTAACTTCTCATCTGACACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026444.3-402s21c1
Sequence:CCGGCCTAAGGCTAAGGGTGGAGAACTCGAGTTCTCCACCCTTAGCCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026444.3-174s21c1
Sequence:CCGGTCCACGAATTTGAAAGATGTACTCGAGTACATCTTTCAAATTCGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026444.3-560s21c1
Sequence:CCGGTCCAACCAATCTGCACCCTATCTCGAGATAGGGTGCAGATTGGTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075858    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026444.2-2060s1c1
Sequence:CCGGGCACCCAACATTTGAGTTATTCTCGAGAATAACTCAAATGTTGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026444.2-560s1c1
Sequence:CCGGTCCAACCAATCTGCACCCTATCTCGAGATAGGGTGCAGATTGGTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026444.2-174s1c1
Sequence:CCGGTCCACGAATTTGAAAGATGTACTCGAGTACATCTTTCAAATTCGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026444.2-402s1c1
Sequence:CCGGCCTAAGGCTAAGGGTGGAGAACTCGAGTTCTCCACCCTTAGCCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026444.2-1050s1c1
Sequence:CCGGGACGTGTCAGATGAGAAGTTACTCGAGTAACTTCTCATCTGACACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026444
VALIDATED
CS MISSION shRNA shRNA Plasmid DNA
citrate synthase
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000324071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026444.3-1050s21c1
Sequence:CCGGGACGTGTCAGATGAGAAGTTACTCGAGTAACTTCTCATCTGACACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026444.3-402s21c1
Sequence:CCGGCCTAAGGCTAAGGGTGGAGAACTCGAGTTCTCCACCCTTAGCCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026444.3-174s21c1
Sequence:CCGGTCCACGAATTTGAAAGATGTACTCGAGTACATCTTTCAAATTCGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026444.3-560s21c1
Sequence:CCGGTCCAACCAATCTGCACCCTATCTCGAGATAGGGTGCAGATTGGTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075858    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026444.2-2060s1c1
Sequence:CCGGGCACCCAACATTTGAGTTATTCTCGAGAATAACTCAAATGTTGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026444.2-560s1c1
Sequence:CCGGTCCAACCAATCTGCACCCTATCTCGAGATAGGGTGCAGATTGGTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026444.2-174s1c1
Sequence:CCGGTCCACGAATTTGAAAGATGTACTCGAGTACATCTTTCAAATTCGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026444.2-402s1c1
Sequence:CCGGCCTAAGGCTAAGGGTGGAGAACTCGAGTTCTCCACCCTTAGCCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026444.2-1050s1c1
Sequence:CCGGGACGTGTCAGATGAGAAGTTACTCGAGTAACTTCTCATCTGACACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026444
VALIDATED
CS MISSION shRNA Lentiviral Transduction Particles
citrate synthase
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000324071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026444.3-1050s21c1
Sequence:CCGGGACGTGTCAGATGAGAAGTTACTCGAGTAACTTCTCATCTGACACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026444.3-402s21c1
Sequence:CCGGCCTAAGGCTAAGGGTGGAGAACTCGAGTTCTCCACCCTTAGCCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026444.3-174s21c1
Sequence:CCGGTCCACGAATTTGAAAGATGTACTCGAGTACATCTTTCAAATTCGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026444.3-560s21c1
Sequence:CCGGTCCAACCAATCTGCACCCTATCTCGAGATAGGGTGCAGATTGGTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075858    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026444.2-2060s1c1
Sequence:CCGGGCACCCAACATTTGAGTTATTCTCGAGAATAACTCAAATGTTGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026444.2-560s1c1
Sequence:CCGGTCCAACCAATCTGCACCCTATCTCGAGATAGGGTGCAGATTGGTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026444.2-174s1c1
Sequence:CCGGTCCACGAATTTGAAAGATGTACTCGAGTACATCTTTCAAATTCGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026444.2-402s1c1
Sequence:CCGGCCTAAGGCTAAGGGTGGAGAACTCGAGTTCTCCACCCTTAGCCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026444.2-1050s1c1
Sequence:CCGGGACGTGTCAGATGAGAAGTTACTCGAGTAACTTCTCATCTGACACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004077
VALIDATED
CS MISSION shRNA Bacterial Glycerol Stock
citrate synthase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000290791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004077.2-279s21c1
Sequence:CCGGCCACGAATTTGAAAGACATATCTCGAGATATGTCTTTCAAATTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004077.2-322s21c1
Sequence:CCGGGCAGGCCAGAATTAAGACTTTCTCGAGAAAGTCTTAATTCTGGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004077.2-1280s21c1
Sequence:CCGGGCTCTGAAACACCTGCCTAATCTCGAGATTAGGCAGGTGTTTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004077.2-827s21c1
Sequence:CCGGGCAGCAAAGATCTACCGAAATCTCGAGATTTCGGTAGATCTTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004077.2-1280s1c1
Sequence:CCGGGCTCTGAAACACCTGCCTAATCTCGAGATTAGGCAGGTGTTTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004077.2-279s1c1
Sequence:CCGGCCACGAATTTGAAAGACATATCTCGAGATATGTCTTTCAAATTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004077.2-322s1c1
Sequence:CCGGGCAGGCCAGAATTAAGACTTTCTCGAGAAAGTCTTAATTCTGGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004077.2-470s1c1
Sequence:CCGGCGAGGCTTTAGTATCCCTGAACTCGAGTTCAGGGATACTAAAGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004077.2-827s1c1
Sequence:CCGGGCAGCAAAGATCTACCGAAATCTCGAGATTTCGGTAGATCTTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004077
VALIDATED
CS MISSION shRNA shRNA Plasmid DNA
citrate synthase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000290791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004077.2-279s21c1
Sequence:CCGGCCACGAATTTGAAAGACATATCTCGAGATATGTCTTTCAAATTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004077.2-322s21c1
Sequence:CCGGGCAGGCCAGAATTAAGACTTTCTCGAGAAAGTCTTAATTCTGGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004077.2-1280s21c1
Sequence:CCGGGCTCTGAAACACCTGCCTAATCTCGAGATTAGGCAGGTGTTTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004077.2-827s21c1
Sequence:CCGGGCAGCAAAGATCTACCGAAATCTCGAGATTTCGGTAGATCTTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004077.2-1280s1c1
Sequence:CCGGGCTCTGAAACACCTGCCTAATCTCGAGATTAGGCAGGTGTTTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004077.2-279s1c1
Sequence:CCGGCCACGAATTTGAAAGACATATCTCGAGATATGTCTTTCAAATTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004077.2-322s1c1
Sequence:CCGGGCAGGCCAGAATTAAGACTTTCTCGAGAAAGTCTTAATTCTGGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004077.2-470s1c1
Sequence:CCGGCGAGGCTTTAGTATCCCTGAACTCGAGTTCAGGGATACTAAAGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004077.2-827s1c1
Sequence:CCGGGCAGCAAAGATCTACCGAAATCTCGAGATTTCGGTAGATCTTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004077
VALIDATED
CS MISSION shRNA Lentiviral Transduction Particles
citrate synthase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000290791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004077.2-279s21c1
Sequence:CCGGCCACGAATTTGAAAGACATATCTCGAGATATGTCTTTCAAATTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004077.2-322s21c1
Sequence:CCGGGCAGGCCAGAATTAAGACTTTCTCGAGAAAGTCTTAATTCTGGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004077.2-1280s21c1
Sequence:CCGGGCTCTGAAACACCTGCCTAATCTCGAGATTAGGCAGGTGTTTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004077.2-827s21c1
Sequence:CCGGGCAGCAAAGATCTACCGAAATCTCGAGATTTCGGTAGATCTTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004077.2-1280s1c1
Sequence:CCGGGCTCTGAAACACCTGCCTAATCTCGAGATTAGGCAGGTGTTTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004077.2-279s1c1
Sequence:CCGGCCACGAATTTGAAAGACATATCTCGAGATATGTCTTTCAAATTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004077.2-322s1c1
Sequence:CCGGGCAGGCCAGAATTAAGACTTTCTCGAGAAAGTCTTAATTCTGGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004077.2-470s1c1
Sequence:CCGGCGAGGCTTTAGTATCCCTGAACTCGAGTTCAGGGATACTAAAGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004077.2-827s1c1
Sequence:CCGGGCAGCAAAGATCTACCGAAATCTCGAGATTTCGGTAGATCTTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks