EMAIL THIS PAGE TO A FRIEND

CSAD

cysteine sulfinic acid decarboxylase

80 Gene Product Result for
Synonyms: CSD PCAP
UniProtKB ID: Q9Y600, A8K0U4, Q4QQH9, Q9UNJ5, Q9Y601
Gene ID:
Human(51380) Summary: This gene encodes a member of the group 2 decarboxylase family. A similar protein in rodents plays a role in multiple biological processes as the rate-limiting enzyme in taurine biosynthesis, catalyzing the decarboxylation of cysteinesulfinate to hypotaurine. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
Mouse(246277) cysteine sulfinic acid decarboxylase
Rat(60356) cysteine sulfinic acid decarboxylase
Zebrafish(492476) cysteine sulfinic acid decarboxylase
cow(516241) cysteine sulfinic acid decarboxylase
Horse(100061989) cysteine sulfinic acid decarboxylase
domestic cat(101099732) cysteine sulfinic acid decarboxylase
dog(486510) cysteine sulfinic acid decarboxylase
chicken(426184) cysteine sulfinic acid decarboxylase
naked mole-rat(101721018) cysteine sulfinic acid decarboxylase
domestic guinea pig(100734095) cysteine sulfinic acid decarboxylase
sheep(101106670) cysteine sulfinic acid decarboxylase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015989 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015989 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015989 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144942 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144942 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144942 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015989 Rosetta Predictions human pricing
NM_001134454 Rosetta Predictions rat pricing
NM_021750 Rosetta Predictions rat pricing
NM_144942 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015989 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00157111 predicted 778
2 SASI_Hs02_00348668 predicted 949
3 SASI_Hs01_00157112 predicted 772
4 SASI_Hs01_00157114 predicted 942
5 SASI_Hs01_00157115 predicted 864
6 SASI_Hs01_00157116 predicted 790
7 SASI_Hs01_00157117 predicted 573
8 SASI_Hs01_00157118 predicted 985
9 SASI_Hs01_00157119 predicted 1592
10 SASI_Hs01_00157120 predicted 1393
11 SASI_Hs01_00157113 predicted 676
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134454 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00256359 predicted 342
2 SASI_Rn02_00256360 predicted 499
3 SASI_Rn02_00256361 predicted 382
4 SASI_Rn02_00256362 predicted 576
5 SASI_Rn02_00256363 predicted 556
6 SASI_Rn02_00256364 predicted 477
7 SASI_Rn02_00256365 predicted 467
8 SASI_Rn02_00256366 predicted 382
9 SASI_Rn02_00256367 predicted 460
10 SASI_Rn02_00256368 predicted 491
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021750 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00262799 predicted 355
2 SASI_Rn02_00262800 predicted 509
3 SASI_Rn01_00049788 predicted 389
4 SASI_Rn02_00262801 predicted 596
5 SASI_Rn02_00262802 predicted 573
6 SASI_Rn01_00049791 predicted 480
7 SASI_Rn02_00262803 predicted 477
8 SASI_Rn02_00262804 predicted 387
9 SASI_Rn02_00262805 predicted 463
10 SASI_Rn02_00262806 predicted 500
11 SASI_Rn01_00049786 predicted 1223
12 SASI_Rn01_00049787 predicted 1484
13 SASI_Rn01_00049789 predicted 357
14 SASI_Rn01_00049790 predicted 1547
15 SASI_Rn01_00049792 predicted 789
16 SASI_Rn01_00049793 predicted 207
17 SASI_Rn01_00049794 predicted 1676
18 SASI_Rn01_00049795 predicted 1560
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144942 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00130311 predicted 501
2 SASI_Mm01_00130312 predicted 496
3 SASI_Mm01_00130313 predicted 282
4 SASI_Mm01_00130314 predicted 384
5 SASI_Mm01_00130315 predicted 1579
6 SASI_Mm01_00130316 predicted 1665
7 SASI_Mm01_00130317 predicted 882
8 SASI_Mm01_00130318 predicted 1066
9 SASI_Mm01_00130319 predicted 837
10 SASI_Mm02_00340466 predicted 643
11 SASI_Mm01_00130320 predicted 794
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015989
CSAD MISSION shRNA Bacterial Glycerol Stock
cysteine sulfinic acid decarboxylase
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078523    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015989.3-2218s1c1
Sequence:CCGGCTACTAACTTTCTCCTAACTACTCGAGTAGTTAGGAGAAAGTTAGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015989.3-1329s1c1
Sequence:CCGGGCAGGACAAGTTCTACGATGTCTCGAGACATCGTAGAACTTGTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015989.3-653s1c1
Sequence:CCGGCCAGCCAGTACACATATGAAACTCGAGTTTCATATGTGTACTGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015989.3-1536s1c1
Sequence:CCGGTGAGTTTGTCAATGTGTGTTTCTCGAGAAACACACATTGACAAACTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015989.3-1592s1c1
Sequence:CCGGAGAGTCCAGATTACCACGAAACTCGAGTTTCGTGGTAATCTGGACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015989.4-1559s21c1
Sequence:CCGGGGAAGGGTTTGAGCTAGTCATCTCGAGATGACTAGCTCAAACCCTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421505    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015989.4-2184s21c1
Sequence:CCGGAGTACGAGACTCTGTTCCAAACTCGAGTTTGGAACAGAGTCTCGTACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015989
CSAD MISSION shRNA shRNA Plasmid DNA
cysteine sulfinic acid decarboxylase
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078523    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015989.3-2218s1c1
Sequence:CCGGCTACTAACTTTCTCCTAACTACTCGAGTAGTTAGGAGAAAGTTAGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015989.3-1329s1c1
Sequence:CCGGGCAGGACAAGTTCTACGATGTCTCGAGACATCGTAGAACTTGTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015989.3-653s1c1
Sequence:CCGGCCAGCCAGTACACATATGAAACTCGAGTTTCATATGTGTACTGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015989.3-1536s1c1
Sequence:CCGGTGAGTTTGTCAATGTGTGTTTCTCGAGAAACACACATTGACAAACTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015989.3-1592s1c1
Sequence:CCGGAGAGTCCAGATTACCACGAAACTCGAGTTTCGTGGTAATCTGGACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015989.4-1559s21c1
Sequence:CCGGGGAAGGGTTTGAGCTAGTCATCTCGAGATGACTAGCTCAAACCCTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421505    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015989.4-2184s21c1
Sequence:CCGGAGTACGAGACTCTGTTCCAAACTCGAGTTTGGAACAGAGTCTCGTACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015989
CSAD MISSION shRNA Lentiviral Transduction Particles
cysteine sulfinic acid decarboxylase
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078523    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015989.3-2218s1c1
Sequence:CCGGCTACTAACTTTCTCCTAACTACTCGAGTAGTTAGGAGAAAGTTAGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015989.3-1329s1c1
Sequence:CCGGGCAGGACAAGTTCTACGATGTCTCGAGACATCGTAGAACTTGTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015989.3-653s1c1
Sequence:CCGGCCAGCCAGTACACATATGAAACTCGAGTTTCATATGTGTACTGGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015989.3-1536s1c1
Sequence:CCGGTGAGTTTGTCAATGTGTGTTTCTCGAGAAACACACATTGACAAACTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015989.3-1592s1c1
Sequence:CCGGAGAGTCCAGATTACCACGAAACTCGAGTTTCGTGGTAATCTGGACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015989.4-1559s21c1
Sequence:CCGGGGAAGGGTTTGAGCTAGTCATCTCGAGATGACTAGCTCAAACCCTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421505    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015989.4-2184s21c1
Sequence:CCGGAGTACGAGACTCTGTTCCAAACTCGAGTTTGGAACAGAGTCTCGTACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144942
VALIDATED
CSAD MISSION shRNA Bacterial Glycerol Stock
cysteine sulfinic acid decarboxylase
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144942.1-1183s1c1
Sequence:CCGGGCAAGACAAGTTCTACGATGTCTCGAGACATCGTAGAACTTGTCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144942.1-1595s1c1
Sequence:CCGGCAGGCCGATATAGATTTCCTTCTCGAGAAGGAAATCTATATCGGCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144942.1-1181s1c1
Sequence:CCGGCAGCAAGACAAGTTCTACGATCTCGAGATCGTAGAACTTGTCTTGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144942.4-1336s21c1
Sequence:CCGGTACTTGGTGGAGGAGATTAAACTCGAGTTTAATCTCCTCCACCAAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144942.4-936s21c1
Sequence:CCGGGGATGCAATTGCCGATGTTTGCTCGAGCAAACATCGGCAATTGCATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144942.4-429s21c1
Sequence:CCGGCCGGTTCTTCAACCAGCTCTTCTCGAGAAGAGCTGGTTGAAGAACCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327499    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144942.4-2046s21c1
Sequence:CCGGGCTGGATATGAGTTTATGAATCTCGAGATTCATAAACTCATATCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144942.4-1180s21c1
Sequence:CCGGCAGCAAGACAAGTTCTACGATCTCGAGATCGTAGAACTTGTCTTGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144942
VALIDATED
CSAD MISSION shRNA shRNA Plasmid DNA
cysteine sulfinic acid decarboxylase
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144942.1-1183s1c1
Sequence:CCGGGCAAGACAAGTTCTACGATGTCTCGAGACATCGTAGAACTTGTCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144942.1-1595s1c1
Sequence:CCGGCAGGCCGATATAGATTTCCTTCTCGAGAAGGAAATCTATATCGGCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144942.1-1181s1c1
Sequence:CCGGCAGCAAGACAAGTTCTACGATCTCGAGATCGTAGAACTTGTCTTGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144942.4-1336s21c1
Sequence:CCGGTACTTGGTGGAGGAGATTAAACTCGAGTTTAATCTCCTCCACCAAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144942.4-936s21c1
Sequence:CCGGGGATGCAATTGCCGATGTTTGCTCGAGCAAACATCGGCAATTGCATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144942.4-429s21c1
Sequence:CCGGCCGGTTCTTCAACCAGCTCTTCTCGAGAAGAGCTGGTTGAAGAACCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327499    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144942.4-2046s21c1
Sequence:CCGGGCTGGATATGAGTTTATGAATCTCGAGATTCATAAACTCATATCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144942.4-1180s21c1
Sequence:CCGGCAGCAAGACAAGTTCTACGATCTCGAGATCGTAGAACTTGTCTTGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144942
VALIDATED
CSAD MISSION shRNA Lentiviral Transduction Particles
cysteine sulfinic acid decarboxylase
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144942.1-1183s1c1
Sequence:CCGGGCAAGACAAGTTCTACGATGTCTCGAGACATCGTAGAACTTGTCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144942.1-1595s1c1
Sequence:CCGGCAGGCCGATATAGATTTCCTTCTCGAGAAGGAAATCTATATCGGCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144942.1-1181s1c1
Sequence:CCGGCAGCAAGACAAGTTCTACGATCTCGAGATCGTAGAACTTGTCTTGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144942.4-1336s21c1
Sequence:CCGGTACTTGGTGGAGGAGATTAAACTCGAGTTTAATCTCCTCCACCAAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144942.4-936s21c1
Sequence:CCGGGGATGCAATTGCCGATGTTTGCTCGAGCAAACATCGGCAATTGCATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144942.4-429s21c1
Sequence:CCGGCCGGTTCTTCAACCAGCTCTTCTCGAGAAGAGCTGGTTGAAGAACCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327499    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144942.4-2046s21c1
Sequence:CCGGGCTGGATATGAGTTTATGAATCTCGAGATTCATAAACTCATATCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144942.4-1180s21c1
Sequence:CCGGCAGCAAGACAAGTTCTACGATCTCGAGATCGTAGAACTTGTCTTGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)