EMAIL THIS PAGE TO A FRIEND

CSAG1

chondrosarcoma associated gene 1

25 Gene Product Result for
Synonyms: CSAGE CT24.1
Species: Human CSAG1(158511)
UniProtKB ID: Q6PB30, A6NE22
Gene ID:
Human(158511) Summary: This gene encodes a member of a family of tumor antigens. The protein is expressed in chondrosarcomas, but may also be expressed in normal tissues such as testis. Alternative splicing of this gene results in two transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153478 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153478 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153478 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU126011 MISSION® esiRNA esiRNA human CSAG1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001102576 Rosetta Predictions human pricing
NM_153478 Rosetta Predictions human pricing
NM_153479 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102576 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323273 predicted 272
2 SASI_Hs02_00323274 predicted 430
3 SASI_Hs02_00323275 predicted 270
4 SASI_Hs02_00323276 predicted 486
5 SASI_Hs02_00323277 predicted 181
6 SASI_Hs02_00323278 predicted 479
7 SASI_Hs02_00323279 predicted 175
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153478 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00166159 predicted 488
2 SASI_Hs01_00166158 predicted 651
3 SASI_Hs02_00367304 predicted 488
4 SASI_Hs02_00367305 predicted 475
5 SASI_Hs01_00166160 predicted 704
6 SASI_Hs01_00166161 predicted 396
7 SASI_Hs01_00166162 predicted 695
8 SASI_Hs01_00166163 predicted 386
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153479 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00132484 predicted 442
2 SASI_Hs01_00132485 predicted 289
3 SASI_Hs01_00132486 predicted 492
4 SASI_Hs01_00132487 predicted 495
5 SASI_Hs01_00132488 predicted 477
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153478
CSAG1 MISSION shRNA Bacterial Glycerol Stock
chondrosarcoma associated gene 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166706    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153478.1-483s1c1
Sequence:CCGGCAACACCAAAGAGGTTCCCAACTCGAGTTGGGAACCTCTTTGGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165653    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153478.1-395s1c1
Sequence:CCGGGACTGGAGTAGACTGTACAGACTCGAGTCTGTACAGTCTACTCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165409    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153478.1-488s1c1
Sequence:CCGGCCAAAGAGGTTCCCAAGACAACTCGAGTTGTCTTGGGAACCTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164670    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153478.1-425s1c1
Sequence:CCGGCTGGTGAAGATGTCCAGGAAACTCGAGTTTCCTGGACATCTTCACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162850    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153478.1-633s1c1
Sequence:CCGGCGAACCAGGAACTCAATCAAACTCGAGTTTGATTGAGTTCCTGGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163988    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153478.1-532s1c1
Sequence:CCGGCAAGGAAGTTCCAGGAACAAACTCGAGTTTGTTCCTGGAACTTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164784    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153478.1-478s1c1
Sequence:CCGGCCCATCAACACCAAAGAGGTTCTCGAGAACCTCTTTGGTGTTGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165488    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153478.1-530s1c1
Sequence:CCGGGTCAAGGAAGTTCCAGGAACACTCGAGTGTTCCTGGAACTTCCTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165732    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153478.1-472s1c1
Sequence:CCGGCAACCACCCATCAACACCAAACTCGAGTTTGGTGTTGATGGGTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165875    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153478.1-400s1c1
Sequence:CCGGGAGTAGACTGTACAGAGACACCTCGAGGTGTCTCTGTACAGTCTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165796    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153478.1-632s1c1
Sequence:CCGGCCGAACCAGGAACTCAATCAACTCGAGTTGATTGAGTTCCTGGTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153478
CSAG1 MISSION shRNA shRNA Plasmid DNA
chondrosarcoma associated gene 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166706    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153478.1-483s1c1
Sequence:CCGGCAACACCAAAGAGGTTCCCAACTCGAGTTGGGAACCTCTTTGGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165653    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153478.1-395s1c1
Sequence:CCGGGACTGGAGTAGACTGTACAGACTCGAGTCTGTACAGTCTACTCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165409    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153478.1-488s1c1
Sequence:CCGGCCAAAGAGGTTCCCAAGACAACTCGAGTTGTCTTGGGAACCTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164670    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153478.1-425s1c1
Sequence:CCGGCTGGTGAAGATGTCCAGGAAACTCGAGTTTCCTGGACATCTTCACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162850    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153478.1-633s1c1
Sequence:CCGGCGAACCAGGAACTCAATCAAACTCGAGTTTGATTGAGTTCCTGGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163988    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153478.1-532s1c1
Sequence:CCGGCAAGGAAGTTCCAGGAACAAACTCGAGTTTGTTCCTGGAACTTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164784    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153478.1-478s1c1
Sequence:CCGGCCCATCAACACCAAAGAGGTTCTCGAGAACCTCTTTGGTGTTGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165488    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153478.1-530s1c1
Sequence:CCGGGTCAAGGAAGTTCCAGGAACACTCGAGTGTTCCTGGAACTTCCTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165732    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153478.1-472s1c1
Sequence:CCGGCAACCACCCATCAACACCAAACTCGAGTTTGGTGTTGATGGGTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165875    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153478.1-400s1c1
Sequence:CCGGGAGTAGACTGTACAGAGACACCTCGAGGTGTCTCTGTACAGTCTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165796    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153478.1-632s1c1
Sequence:CCGGCCGAACCAGGAACTCAATCAACTCGAGTTGATTGAGTTCCTGGTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153478
CSAG1 MISSION shRNA Lentiviral Transduction Particles
chondrosarcoma associated gene 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166706    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153478.1-483s1c1
Sequence:CCGGCAACACCAAAGAGGTTCCCAACTCGAGTTGGGAACCTCTTTGGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165653    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153478.1-395s1c1
Sequence:CCGGGACTGGAGTAGACTGTACAGACTCGAGTCTGTACAGTCTACTCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165409    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153478.1-488s1c1
Sequence:CCGGCCAAAGAGGTTCCCAAGACAACTCGAGTTGTCTTGGGAACCTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164670    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153478.1-425s1c1
Sequence:CCGGCTGGTGAAGATGTCCAGGAAACTCGAGTTTCCTGGACATCTTCACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162850    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153478.1-633s1c1
Sequence:CCGGCGAACCAGGAACTCAATCAAACTCGAGTTTGATTGAGTTCCTGGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163988    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153478.1-532s1c1
Sequence:CCGGCAAGGAAGTTCCAGGAACAAACTCGAGTTTGTTCCTGGAACTTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164784    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153478.1-478s1c1
Sequence:CCGGCCCATCAACACCAAAGAGGTTCTCGAGAACCTCTTTGGTGTTGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165488    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153478.1-530s1c1
Sequence:CCGGGTCAAGGAAGTTCCAGGAACACTCGAGTGTTCCTGGAACTTCCTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165732    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153478.1-472s1c1
Sequence:CCGGCAACCACCCATCAACACCAAACTCGAGTTTGGTGTTGATGGGTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165875    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153478.1-400s1c1
Sequence:CCGGGAGTAGACTGTACAGAGACACCTCGAGGTGTCTCTGTACAGTCTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165796    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153478.1-632s1c1
Sequence:CCGGCCGAACCAGGAACTCAATCAACTCGAGTTGATTGAGTTCCTGGTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks