EMAIL THIS PAGE TO A FRIEND

CSAG3

CSAG family, member 3

21 Gene Product Result for
Synonyms: CSAG3A CT24.2
Species: Human CSAG3(389903)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_203311 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_203311 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_203311 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001129826 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001129826 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001129826 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_203311 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203311 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00111442 predicted 566
2 SASI_Hs01_00111443 predicted 395
3 SASI_Hs01_00111444 predicted 619
4 SASI_Hs01_00111445 predicted 398
5 SASI_Hs01_00111446 predicted 414
6 SASI_Hs01_00111447 predicted 413
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_203311
CSAG3 MISSION shRNA Bacterial Glycerol Stock
CSAG family, member 3
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000183478    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203311.1-655s1c1
Sequence:CCGGGAGACTTCAAGTCTATCTGAACTCGAGTTCAGATAGACTTGAAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180260    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203311.1-620s1c1
Sequence:CCGGCTCTTCGGACAGCCAGTAATTCTCGAGAATTACTGGCTGTCCGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_203311
CSAG3 MISSION shRNA shRNA Plasmid DNA
CSAG family, member 3
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000183478    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203311.1-655s1c1
Sequence:CCGGGAGACTTCAAGTCTATCTGAACTCGAGTTCAGATAGACTTGAAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180260    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203311.1-620s1c1
Sequence:CCGGCTCTTCGGACAGCCAGTAATTCTCGAGAATTACTGGCTGTCCGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_203311
CSAG3 MISSION shRNA Lentiviral Transduction Particles
CSAG family, member 3
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000183478    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203311.1-655s1c1
Sequence:CCGGGAGACTTCAAGTCTATCTGAACTCGAGTTCAGATAGACTTGAAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180260    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203311.1-620s1c1
Sequence:CCGGCTCTTCGGACAGCCAGTAATTCTCGAGAATTACTGGCTGTCCGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001129826
CSAG3 MISSION shRNA Bacterial Glycerol Stock
CSAG family, member 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129826.1-329s21c1
Sequence:CCGGACACCAAAGAGGCGAGGAAGTCTCGAGACTTCCTCGCCTCTTTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129826.1-147s21c1
Sequence:CCGGTCTACCACAAGACTAACATAACTCGAGTTATGTTAGTCTTGTGGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129826.1-259s21c1
Sequence:CCGGAGACGCTGGTCTGGTGAAGATCTCGAGATCTTCACCAGACCAGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129826.1-370s21c1
Sequence:CCGGTGGCCCAGAAGCCCTATCAAACTCGAGTTTGATAGGGCTTCTGGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244713    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001129826.1-601s21c1
Sequence:CCGGCTCTTCGGACAGCCAGTAATTCTCGAGAATTACTGGCTGTCCGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001129826
CSAG3 MISSION shRNA shRNA Plasmid DNA
CSAG family, member 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129826.1-329s21c1
Sequence:CCGGACACCAAAGAGGCGAGGAAGTCTCGAGACTTCCTCGCCTCTTTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129826.1-147s21c1
Sequence:CCGGTCTACCACAAGACTAACATAACTCGAGTTATGTTAGTCTTGTGGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129826.1-259s21c1
Sequence:CCGGAGACGCTGGTCTGGTGAAGATCTCGAGATCTTCACCAGACCAGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129826.1-370s21c1
Sequence:CCGGTGGCCCAGAAGCCCTATCAAACTCGAGTTTGATAGGGCTTCTGGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244713    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001129826.1-601s21c1
Sequence:CCGGCTCTTCGGACAGCCAGTAATTCTCGAGAATTACTGGCTGTCCGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001129826
CSAG3 MISSION shRNA Lentiviral Transduction Particles
CSAG family, member 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129826.1-329s21c1
Sequence:CCGGACACCAAAGAGGCGAGGAAGTCTCGAGACTTCCTCGCCTCTTTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129826.1-147s21c1
Sequence:CCGGTCTACCACAAGACTAACATAACTCGAGTTATGTTAGTCTTGTGGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129826.1-259s21c1
Sequence:CCGGAGACGCTGGTCTGGTGAAGATCTCGAGATCTTCACCAGACCAGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129826.1-370s21c1
Sequence:CCGGTGGCCCAGAAGCCCTATCAAACTCGAGTTTGATAGGGCTTCTGGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244713    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001129826.1-601s21c1
Sequence:CCGGCTCTTCGGACAGCCAGTAATTCTCGAGAATTACTGGCTGTCCGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks