EMAIL THIS PAGE TO A FRIEND

CSDC2

cold shock domain containing C2, RNA binding

67 Gene Product Result for
Synonyms: PIPPIN dJ347H13.2
UniProtKB ID: Q9Y534, Q8ND37
Gene ID:
Mouse(105859) cold shock domain containing C2, RNA binding
Rat(266600) cold shock domain containing C2, RNA binding
sheep(101111621) cold shock domain containing C2, RNA binding
domestic guinea pig(100716455) cold shock domain containing C2, RNA binding
naked mole-rat(101704531) cold shock domain containing C2, RNA binding
chicken(425183) cold shock domain containing C2, RNA binding
cow(525364) cold shock domain containing C2, RNA binding
domestic cat(101080644) cold shock domain containing C2, RNA binding
dog(481231) cold shock domain containing C2, RNA binding
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145473 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145473 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145473 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014460 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014460 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014460 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU151521 MISSION® esiRNA esiRNA human CSDC2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014460 Rosetta Predictions human pricing
XM_001077363 Rosetta Predictions rat pricing
XM_345860 Rosetta Predictions rat pricing
NM_145473 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014460 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00176940 predicted 792
2 SASI_Hs01_00176941 predicted 492
3 SASI_Hs01_00176942 predicted 645
4 SASI_Hs01_00176943 predicted 888
5 SASI_Hs01_00176944 predicted 849
6 SASI_Hs01_00176945 predicted 942
7 SASI_Hs01_00176946 predicted 759
8 SASI_Hs01_00176947 predicted 2055
9 SASI_Hs01_00176948 predicted 2037
10 SASI_Hs01_00176949 predicted 2063
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077363 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00356790 predicted 820
2 SASI_Rn02_00356791 predicted 696
3 SASI_Rn02_00356792 predicted 970
4 SASI_Rn02_00356793 predicted 687
5 SASI_Rn02_00356794 predicted 1211
6 SASI_Rn02_00356795 predicted 930
7 SASI_Rn02_00356796 predicted 517
8 SASI_Rn02_00356797 predicted 846
9 SASI_Rn02_00356798 predicted 1209
10 SASI_Rn02_00356799 predicted 250
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_345860 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00398757 predicted 973
2 SASI_Rn02_00398758 predicted 842
3 SASI_Rn02_00398759 predicted 1116
4 SASI_Rn02_00398760 predicted 833
5 SASI_Rn02_00398761 predicted 1351
6 SASI_Rn02_00398762 predicted 1074
7 SASI_Rn02_00398763 predicted 664
8 SASI_Rn02_00398764 predicted 992
9 SASI_Rn02_00398765 predicted 1362
10 SASI_Rn02_00398766 predicted 396
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145473 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00340877 predicted 868
2 SASI_Mm01_00090877 predicted 595
3 SASI_Mm01_00090878 predicted 271
4 SASI_Mm01_00090879 predicted 366
5 SASI_Mm01_00090880 predicted 1057
6 SASI_Mm01_00090881 predicted 499
7 SASI_Mm01_00090882 predicted 430
8 SASI_Mm01_00090883 predicted 862
9 SASI_Mm01_00090884 predicted 1004
10 SASI_Mm01_00090885 predicted 812
11 SASI_Mm01_00090876 predicted 779
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145473
CSDC2 MISSION shRNA Bacterial Glycerol Stock
cold shock domain containing C2, RNA binding
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000099730    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145473.1-1742s1c1
Sequence:CCGGCCTGGCACAATAGTGACCTTTCTCGAGAAAGGTCACTATTGTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145473.1-470s1c1
Sequence:CCGGGAGGACATCTTCGTGCATGTTCTCGAGAACATGCACGAAGATGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145473.1-442s1c1
Sequence:CCGGCGGCTTCATCACGCCTGAGAACTCGAGTTCTCAGGCGTGATGAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145473.1-527s1c1
Sequence:CCGGGACGAGGTGACCTACAAGATTCTCGAGAATCTTGTAGGTCACCTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145473.1-526s1c1
Sequence:CCGGAGACGAGGTGACCTACAAGATCTCGAGATCTTGTAGGTCACCTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145473
CSDC2 MISSION shRNA shRNA Plasmid DNA
cold shock domain containing C2, RNA binding
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000099730    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145473.1-1742s1c1
Sequence:CCGGCCTGGCACAATAGTGACCTTTCTCGAGAAAGGTCACTATTGTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145473.1-470s1c1
Sequence:CCGGGAGGACATCTTCGTGCATGTTCTCGAGAACATGCACGAAGATGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145473.1-442s1c1
Sequence:CCGGCGGCTTCATCACGCCTGAGAACTCGAGTTCTCAGGCGTGATGAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145473.1-527s1c1
Sequence:CCGGGACGAGGTGACCTACAAGATTCTCGAGAATCTTGTAGGTCACCTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145473.1-526s1c1
Sequence:CCGGAGACGAGGTGACCTACAAGATCTCGAGATCTTGTAGGTCACCTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145473
CSDC2 MISSION shRNA Lentiviral Transduction Particles
cold shock domain containing C2, RNA binding
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000099730    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145473.1-1742s1c1
Sequence:CCGGCCTGGCACAATAGTGACCTTTCTCGAGAAAGGTCACTATTGTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145473.1-470s1c1
Sequence:CCGGGAGGACATCTTCGTGCATGTTCTCGAGAACATGCACGAAGATGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145473.1-442s1c1
Sequence:CCGGCGGCTTCATCACGCCTGAGAACTCGAGTTCTCAGGCGTGATGAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145473.1-527s1c1
Sequence:CCGGGACGAGGTGACCTACAAGATTCTCGAGAATCTTGTAGGTCACCTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145473.1-526s1c1
Sequence:CCGGAGACGAGGTGACCTACAAGATCTCGAGATCTTGTAGGTCACCTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014460
CSDC2 MISSION shRNA Bacterial Glycerol Stock
cold shock domain containing C2, RNA binding
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014460.2-582s1c1
Sequence:CCGGGACCTACAAGATGTGCCCTATCTCGAGATAGGGCACATCTTGTAGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014460.2-514s1c1
Sequence:CCGGTCCGAGGACATCTTCGTACATCTCGAGATGTACGAAGATGTCCTCGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014460.2-573s1c1
Sequence:CCGGCGACGAGGTGACCTACAAGATCTCGAGATCTTGTAGGTCACCTCGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014460.2-460s1c1
Sequence:CCGGTGTAAGCAGTTCTCACGCTCACTCGAGTGAGCGTGAGAACTGCTTACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014460.2-443s1c1
Sequence:CCGGCCGTGTTCAAGGGCGTCTGTACTCGAGTACAGACGCCCTTGAACACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014460
CSDC2 MISSION shRNA shRNA Plasmid DNA
cold shock domain containing C2, RNA binding
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014460.2-582s1c1
Sequence:CCGGGACCTACAAGATGTGCCCTATCTCGAGATAGGGCACATCTTGTAGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014460.2-514s1c1
Sequence:CCGGTCCGAGGACATCTTCGTACATCTCGAGATGTACGAAGATGTCCTCGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014460.2-573s1c1
Sequence:CCGGCGACGAGGTGACCTACAAGATCTCGAGATCTTGTAGGTCACCTCGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014460.2-460s1c1
Sequence:CCGGTGTAAGCAGTTCTCACGCTCACTCGAGTGAGCGTGAGAACTGCTTACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014460.2-443s1c1
Sequence:CCGGCCGTGTTCAAGGGCGTCTGTACTCGAGTACAGACGCCCTTGAACACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014460
CSDC2 MISSION shRNA Lentiviral Transduction Particles
cold shock domain containing C2, RNA binding
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014460.2-582s1c1
Sequence:CCGGGACCTACAAGATGTGCCCTATCTCGAGATAGGGCACATCTTGTAGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014460.2-514s1c1
Sequence:CCGGTCCGAGGACATCTTCGTACATCTCGAGATGTACGAAGATGTCCTCGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014460.2-573s1c1
Sequence:CCGGCGACGAGGTGACCTACAAGATCTCGAGATCTTGTAGGTCACCTCGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014460.2-460s1c1
Sequence:CCGGTGTAAGCAGTTCTCACGCTCACTCGAGTGAGCGTGAGAACTGCTTACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014460.2-443s1c1
Sequence:CCGGCCGTGTTCAAGGGCGTCTGTACTCGAGTACAGACGCCCTTGAACACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks