EMAIL THIS PAGE TO A FRIEND

CSDE1

cold shock domain containing E1, RNA-binding

170 Gene Product Result for
Synonyms: D1S155E RP5-1000E10.3 UNR
Gene ID:
Mouse(229663) cold shock domain containing E1, RNA binding
Rat(117180) cold shock domain containing E1, RNA binding
Zebrafish(337096) cold shock domain containing E1, RNA-binding
chicken(419886) cold shock domain containing E1, RNA-binding
domestic cat(101098614) cold shock domain containing E1, RNA-binding
cow(513993) cold shock domain containing E1, RNA-binding
Horse(100065444) cold shock domain containing E1, RNA-binding
dog(475807) cold shock domain containing E1, RNA-binding
naked mole-rat(101717101) cold shock domain containing E1, RNA-binding
domestic guinea pig(100731152) cold shock domain containing E1, RNA-binding
sheep(101102685) cold shock domain containing E1, RNA-binding
Domestic Rabbit(100343480) cold shock domain containing E1, RNA-binding
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007158 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007158 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007158 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144901 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144901 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144901 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001007553 Rosetta Predictions human pricing
NM_007158 Rosetta Predictions human pricing
NM_054006 Rosetta Predictions rat pricing
NM_144901 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007553 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00097578 predicted 1085
2 SASI_Hs01_00097579 predicted 2508
3 SASI_Hs01_00097580 predicted 2340
4 SASI_Hs01_00097581 predicted 2238
5 SASI_Hs02_00305343 predicted 1142
6 SASI_Hs01_00097583 predicted 2652
7 SASI_Hs01_00097584 predicted 1188
8 SASI_Hs01_00097586 predicted 1826
9 SASI_Hs01_00097587 predicted 1259
10 SASI_Hs02_00305344 predicted 2318
11 SASI_Hs01_00097582 predicted 1922
12 SASI_Hs01_00097585 predicted 1185
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007158 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00207314 predicted 992
2 SASI_Hs01_00207315 predicted 2419
3 SASI_Hs01_00207316 predicted 2241
4 SASI_Hs01_00207317 predicted 2146
5 SASI_Hs02_00343088 predicted 1049
6 SASI_Hs01_00207319 predicted 2558
7 SASI_Hs01_00207320 predicted 1088
8 SASI_Hs02_00343089 predicted 1736
9 SASI_Hs01_00207322 predicted 1162
10 SASI_Hs01_00207323 predicted 2227
11 SASI_Hs01_00207318 predicted 1833
12 SASI_Hs01_00207321 predicted 1089
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_054006 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00059474 predicted 726
2 SASI_Rn01_00059475 predicted 1219
3 SASI_Rn02_00267012 predicted 2257
4 SASI_Rn01_00059478 predicted 831
5 SASI_Rn01_00059479 predicted 619
6 SASI_Rn01_00059480 predicted 1094
7 SASI_Rn02_00267013 predicted 1316
8 SASI_Rn01_00059482 predicted 650
9 SASI_Rn01_00059483 predicted 901
10 SASI_Rn02_00267014 predicted 2150
11 SASI_Rn01_00059476 predicted 2443
12 SASI_Rn01_00059477 predicted 1574
13 SASI_Rn01_00059481 predicted 1676
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144901 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00340362 predicted 1082
2 SASI_Mm02_00340363 predicted 1989
3 SASI_Mm02_00340364 predicted 1566
4 SASI_Mm02_00340365 predicted 2790
5 SASI_Mm02_00340366 predicted 2652
6 SASI_Mm02_00340367 predicted 1914
7 SASI_Mm02_00340368 predicted 1964
8 SASI_Mm02_00340369 predicted 1178
9 SASI_Mm02_00340370 predicted 1253
10 SASI_Mm02_00340371 predicted 2016
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007158
VALIDATED
CSDE1 MISSION shRNA Bacterial Glycerol Stock
cold shock domain containing E1, RNA-binding
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007158.3-1586s1c1
Sequence:CCGGCGGTTTCATTTCATTCCCATTCTCGAGAATGGGAATGAAATGAAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007158.3-1451s1c1
Sequence:CCGGCCTTCCCACTTCCAGTGAAATCTCGAGATTTCACTGGAAGTGGGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007158.3-2211s1c1
Sequence:CCGGCGATATGAAAGGTGAGGTCTACTCGAGTAGACCTCACCTTTCATATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007158.3-1322s1c1
Sequence:CCGGCCAATATAGAAGTTCTGTCAACTCGAGTTGACAGAACTTCTATATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007158.3-703s1c1
Sequence:CCGGCCTCCCGAAGAACGAATGAATCTCGAGATTCATTCGTTCTTCGGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007158.4-882s21c1
Sequence:CCGGCTGTAAGTGCTCGCAACATTACTCGAGTAATGTTGCGAGCACTTACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007158.4-1096s21c1
Sequence:CCGGTGCAACAGATGTCAGACTATTCTCGAGAATAGTCTGACATCTGTTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364674    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007158.4-2996s21c1
Sequence:CCGGTGGCGCCTTATAGTATCAATTCTCGAGAATTGATACTATAAGGCGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007158.4-1402s21c1
Sequence:CCGGCACTAATGAAGCCCGAGAAATCTCGAGATTTCTCGGGCTTCATTAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007158.4-565s21c1
Sequence:CCGGGTTAACCTCTTACGGATTTATCTCGAGATAAATCCGTAAGAGGTTAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007158.4-1356s21c1
Sequence:CCGGTAGAGCGAGCAACCAATATAGCTCGAGCTATATTGGTTGCTCGCTCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007158
VALIDATED
CSDE1 MISSION shRNA shRNA Plasmid DNA
cold shock domain containing E1, RNA-binding
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007158.3-1586s1c1
Sequence:CCGGCGGTTTCATTTCATTCCCATTCTCGAGAATGGGAATGAAATGAAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007158.3-1451s1c1
Sequence:CCGGCCTTCCCACTTCCAGTGAAATCTCGAGATTTCACTGGAAGTGGGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007158.3-2211s1c1
Sequence:CCGGCGATATGAAAGGTGAGGTCTACTCGAGTAGACCTCACCTTTCATATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007158.3-1322s1c1
Sequence:CCGGCCAATATAGAAGTTCTGTCAACTCGAGTTGACAGAACTTCTATATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007158.3-703s1c1
Sequence:CCGGCCTCCCGAAGAACGAATGAATCTCGAGATTCATTCGTTCTTCGGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007158.4-882s21c1
Sequence:CCGGCTGTAAGTGCTCGCAACATTACTCGAGTAATGTTGCGAGCACTTACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007158.4-1096s21c1
Sequence:CCGGTGCAACAGATGTCAGACTATTCTCGAGAATAGTCTGACATCTGTTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364674    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007158.4-2996s21c1
Sequence:CCGGTGGCGCCTTATAGTATCAATTCTCGAGAATTGATACTATAAGGCGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007158.4-1402s21c1
Sequence:CCGGCACTAATGAAGCCCGAGAAATCTCGAGATTTCTCGGGCTTCATTAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007158.4-565s21c1
Sequence:CCGGGTTAACCTCTTACGGATTTATCTCGAGATAAATCCGTAAGAGGTTAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007158.4-1356s21c1
Sequence:CCGGTAGAGCGAGCAACCAATATAGCTCGAGCTATATTGGTTGCTCGCTCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007158
VALIDATED
CSDE1 MISSION shRNA Lentiviral Transduction Particles
cold shock domain containing E1, RNA-binding
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007158.3-1586s1c1
Sequence:CCGGCGGTTTCATTTCATTCCCATTCTCGAGAATGGGAATGAAATGAAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007158.3-1451s1c1
Sequence:CCGGCCTTCCCACTTCCAGTGAAATCTCGAGATTTCACTGGAAGTGGGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007158.3-2211s1c1
Sequence:CCGGCGATATGAAAGGTGAGGTCTACTCGAGTAGACCTCACCTTTCATATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007158.3-1322s1c1
Sequence:CCGGCCAATATAGAAGTTCTGTCAACTCGAGTTGACAGAACTTCTATATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007158.3-703s1c1
Sequence:CCGGCCTCCCGAAGAACGAATGAATCTCGAGATTCATTCGTTCTTCGGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007158.4-882s21c1
Sequence:CCGGCTGTAAGTGCTCGCAACATTACTCGAGTAATGTTGCGAGCACTTACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007158.4-1096s21c1
Sequence:CCGGTGCAACAGATGTCAGACTATTCTCGAGAATAGTCTGACATCTGTTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364674    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007158.4-2996s21c1
Sequence:CCGGTGGCGCCTTATAGTATCAATTCTCGAGAATTGATACTATAAGGCGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007158.4-1402s21c1
Sequence:CCGGCACTAATGAAGCCCGAGAAATCTCGAGATTTCTCGGGCTTCATTAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007158.4-565s21c1
Sequence:CCGGGTTAACCTCTTACGGATTTATCTCGAGATAAATCCGTAAGAGGTTAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007158.4-1356s21c1
Sequence:CCGGTAGAGCGAGCAACCAATATAGCTCGAGCTATATTGGTTGCTCGCTCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144901
VALIDATED
CSDE1 MISSION shRNA Bacterial Glycerol Stock
cold shock domain containing E1, RNA-binding
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144901.2-752s1c1
Sequence:CCGGGAAGAACGAATGAACGGACAACTCGAGTTGTCCGTTCATTCGTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182514    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144901.2-3776s1c1
Sequence:CCGGCCCTGTTCAATACAGGCACTTCTCGAGAAGTGCCTGTATTGAACAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144901.2-2822s1c1
Sequence:CCGGGCAGAAAGAAAGATCCGTCAACTCGAGTTGACGGATCTTTCTTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144901.2-2796s1c1
Sequence:CCGGGACCAGATAACTCAATGGGATCTCGAGATCCCATTGAGTTATCTGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144901.2-970s21c1
Sequence:CCGGTGCTGTAAGTGCTCGTAATATCTCGAGATATTACGAGCACTTACAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144901.2-2822s21c1
Sequence:CCGGGCAGAAAGAAAGATCCGTCAACTCGAGTTGACGGATCTTTCTTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276864    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144901.2-3092s21c1
Sequence:CCGGGCGCCTTATAGTGTCAATTTACTCGAGTAAATTGACACTATAAGGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144901.2-752s21c1
Sequence:CCGGGAAGAACGAATGAACGGACAACTCGAGTTGTCCGTTCATTCGTTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144901.2-2796s21c1
Sequence:CCGGGACCAGATAACTCAATGGGATCTCGAGATCCCATTGAGTTATCTGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144901.3-1054s21c1
Sequence:CCGGGTGCTGTAAGTGCTCGTAATACTCGAGTATTACGAGCACTTACAGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144901
VALIDATED
CSDE1 MISSION shRNA shRNA Plasmid DNA
cold shock domain containing E1, RNA-binding
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144901.2-752s1c1
Sequence:CCGGGAAGAACGAATGAACGGACAACTCGAGTTGTCCGTTCATTCGTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182514    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144901.2-3776s1c1
Sequence:CCGGCCCTGTTCAATACAGGCACTTCTCGAGAAGTGCCTGTATTGAACAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144901.2-2822s1c1
Sequence:CCGGGCAGAAAGAAAGATCCGTCAACTCGAGTTGACGGATCTTTCTTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144901.2-2796s1c1
Sequence:CCGGGACCAGATAACTCAATGGGATCTCGAGATCCCATTGAGTTATCTGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144901.2-970s21c1
Sequence:CCGGTGCTGTAAGTGCTCGTAATATCTCGAGATATTACGAGCACTTACAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144901.2-2822s21c1
Sequence:CCGGGCAGAAAGAAAGATCCGTCAACTCGAGTTGACGGATCTTTCTTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276864    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144901.2-3092s21c1
Sequence:CCGGGCGCCTTATAGTGTCAATTTACTCGAGTAAATTGACACTATAAGGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144901.2-752s21c1
Sequence:CCGGGAAGAACGAATGAACGGACAACTCGAGTTGTCCGTTCATTCGTTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144901.2-2796s21c1
Sequence:CCGGGACCAGATAACTCAATGGGATCTCGAGATCCCATTGAGTTATCTGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144901.3-1054s21c1
Sequence:CCGGGTGCTGTAAGTGCTCGTAATACTCGAGTATTACGAGCACTTACAGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144901
VALIDATED
CSDE1 MISSION shRNA Lentiviral Transduction Particles
cold shock domain containing E1, RNA-binding
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144901.2-752s1c1
Sequence:CCGGGAAGAACGAATGAACGGACAACTCGAGTTGTCCGTTCATTCGTTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182514    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144901.2-3776s1c1
Sequence:CCGGCCCTGTTCAATACAGGCACTTCTCGAGAAGTGCCTGTATTGAACAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144901.2-2822s1c1
Sequence:CCGGGCAGAAAGAAAGATCCGTCAACTCGAGTTGACGGATCTTTCTTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144901.2-2796s1c1
Sequence:CCGGGACCAGATAACTCAATGGGATCTCGAGATCCCATTGAGTTATCTGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144901.2-970s21c1
Sequence:CCGGTGCTGTAAGTGCTCGTAATATCTCGAGATATTACGAGCACTTACAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144901.2-2822s21c1
Sequence:CCGGGCAGAAAGAAAGATCCGTCAACTCGAGTTGACGGATCTTTCTTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276864    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144901.2-3092s21c1
Sequence:CCGGGCGCCTTATAGTGTCAATTTACTCGAGTAAATTGACACTATAAGGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144901.2-752s21c1
Sequence:CCGGGAAGAACGAATGAACGGACAACTCGAGTTGTCCGTTCATTCGTTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144901.2-2796s21c1
Sequence:CCGGGACCAGATAACTCAATGGGATCTCGAGATCCCATTGAGTTATCTGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144901.3-1054s21c1
Sequence:CCGGGTGCTGTAAGTGCTCGTAATACTCGAGTATTACGAGCACTTACAGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)