EMAIL THIS PAGE TO A FRIEND

CSE1L

CSE1 chromosome segregation 1-like (yeast)

89 Gene Product Result for
Synonyms: CAS CSE1 XPO2
Gene ID:
Human(1434) Summary: Proteins that carry a nuclear localization signal (NLS) are transported into the nucleus by the importin-alpha/beta heterodimer. Importin-alpha binds the NLS, while importin-beta mediates translocation through the nuclear pore complex. After translocation, RanGTP binds importin-beta and displaces importin-alpha. Importin-alpha must then be returned to the cytoplasm, leaving the NLS protein behind. The protein encoded by this gene binds strongly to NLS-free importin-alpha, and this binding is released in the cytoplasm by the combined action of RANBP1 and RANGAP1. In addition, the encoded protein may play a role both in apoptosis and in cell proliferation. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2012]
Mouse(110750) chromosome segregation 1-like (S. cerevisiae)
Rat(362273) CSE1 chromosome segregation 1-like (yeast)
Zebrafish(30707) chromosome segregation 1-like (S. cerevisiae)
cow(518622) CSE1 chromosome segregation 1-like (yeast)
Horse(100056886) CSE1 chromosome segregation 1-like (yeast)
domestic cat(101081375) CSE1 chromosome segregation 1-like (yeast)
dog(477257) CSE1 chromosome segregation 1-like (yeast)
chicken(419212) CSE1 chromosome segregation 1-like (yeast)
sheep(101120005) CSE1 chromosome segregation 1-like (yeast)
domestic guinea pig(100725108) CSE1 chromosome segregation 1-like (yeast)
naked mole-rat(101705453) CSE1 chromosome segregation 1-like (yeast)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1305923 ANTI-CELLULAR APOPTOSIS SUSCEPTIBILITY(C-TERMINAL) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
western blot pricing
SAB2701766 Anti-cse1l antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
western blot pricing
SAB2100488 Anti-CSE1L antibody produced in rabbit affinity isolated antibody , rat, zebrafish, human, mouse, rabbit, bovine, horse
western blot pricing
HPA038059 Anti-CSE1L antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
HPA038060 Anti-CSE1L antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB4500494 Anti-CSE1L, N-Terminal antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
WH0001434M1 Monoclonal Anti-CSE1L antibody produced in mouse clone 2B7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1400055 Monoclonal Anti-CSE1L antibody produced in mouse clone 3D8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1408897 Monoclonal Anti-CSE1L antibody produced in mouse clone 1C1, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1408898 Monoclonal Anti-CSE1L antibody produced in mouse clone 1C4, ascites fluid, solution human
ELISA, western blot pricing
SAB1408899 Monoclonal Anti-CSE1L antibody produced in mouse clone 3F8, ascites fluid, solution human
ELISA, western blot pricing
SAB1408900 Monoclonal Anti-CSE1L antibody produced in mouse clone 1E4, ascites fluid, solution human
ELISA, western blot pricing
SAB1408901 Monoclonal Anti-CSE1L antibody produced in mouse clone 2F4, ascites fluid, solution human
ELISA, western blot pricing
SAB1403702 Monoclonal Anti-CSE1L, (C-terminal) antibody produced in mouse clone 2C10, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001316 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001316 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001316 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023565 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023565 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023565 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001316 Rosetta Predictions human pricing
NM_001108607 Rosetta Predictions rat pricing
NM_023565 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001316 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00162507 predicted 2693
2 SASI_Hs02_00331606 predicted 1485
3 SASI_Hs01_00162509 predicted 1341
4 SASI_Hs01_00162511 predicted 2665
5 SASI_Hs01_00162513 predicted 545
6 SASI_Hs02_00331607 predicted 2405
7 SASI_Hs01_00162514 predicted 397
8 SASI_Hs01_00162515 predicted 455
9 SASI_Hs01_00162516 predicted 1922
10 SASI_Hs02_00331608 predicted 2644
11 SASI_Hs01_00162508 predicted 1340
12 SASI_Hs01_00162510 predicted 2018
13 SASI_Hs01_00162512 predicted 639
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108607 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240299 predicted 1065
2 SASI_Rn02_00240300 predicted 1628
3 SASI_Rn02_00240301 predicted 1497
4 SASI_Rn02_00240302 predicted 1305
5 SASI_Rn02_00240303 predicted 903
6 SASI_Rn02_00240304 predicted 1376
7 SASI_Rn02_00240305 predicted 581
8 SASI_Rn02_00240306 predicted 1218
9 SASI_Rn02_00240307 predicted 247
10 SASI_Rn02_00240308 predicted 1038
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023565 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00183175 predicted 1373
2 SASI_Mm01_00183176 predicted 2773
3 SASI_Mm01_00183177 predicted 587
4 SASI_Mm01_00183178 predicted 2648
5 SASI_Mm01_00183179 predicted 1674
6 SASI_Mm01_00183180 predicted 2674
7 SASI_Mm02_00327191 predicted 1639
8 SASI_Mm01_00183181 predicted 1214
9 SASI_Mm02_00327192 predicted 1363
10 SASI_Mm01_00183184 predicted 1661
11 SASI_Mm01_00183182 predicted 251
12 SASI_Mm01_00183183 predicted 2073
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001316
VALIDATED
CSE1L MISSION shRNA Bacterial Glycerol Stock
CSE1 chromosome segregation 1-like (yeast)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001316.2-614s21c1
Sequence:CCGGCCGTCATGAATTTAAGTCAAACTCGAGTTTGACTTAAATTCATGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001316.2-1150s21c1
Sequence:CCGGCGCTGACAAGTATCTGTGAAACTCGAGTTTCACAGATACTTGTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001316.2-1469s21c1
Sequence:CCGGGCATGGAATTACACAAGCAAACTCGAGTTTGCTTGTGTAATTCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001316.2-2169s21c1
Sequence:CCGGCCGTCTTCCTATATGGCCTTACTCGAGTAAGGCCATATAGGAAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_001316.2-2316s1c1
Sequence:CCGGCCTGGGTTACTAGGTGTCTTTCTCGAGAAAGACACCTAGTAACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001316.2-1469s1c1
Sequence:CCGGGCATGGAATTACACAAGCAAACTCGAGTTTGCTTGTGTAATTCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001316.2-2169s1c1
Sequence:CCGGCCGTCTTCCTATATGGCCTTACTCGAGTAAGGCCATATAGGAAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001316.2-614s1c1
Sequence:CCGGCCGTCATGAATTTAAGTCAAACTCGAGTTTGACTTAAATTCATGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001316.2-1150s1c1
Sequence:CCGGCGCTGACAAGTATCTGTGAAACTCGAGTTTCACAGATACTTGTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001316
VALIDATED
CSE1L MISSION shRNA shRNA Plasmid DNA
CSE1 chromosome segregation 1-like (yeast)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001316.2-614s21c1
Sequence:CCGGCCGTCATGAATTTAAGTCAAACTCGAGTTTGACTTAAATTCATGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001316.2-1150s21c1
Sequence:CCGGCGCTGACAAGTATCTGTGAAACTCGAGTTTCACAGATACTTGTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001316.2-1469s21c1
Sequence:CCGGGCATGGAATTACACAAGCAAACTCGAGTTTGCTTGTGTAATTCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001316.2-2169s21c1
Sequence:CCGGCCGTCTTCCTATATGGCCTTACTCGAGTAAGGCCATATAGGAAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_001316.2-2316s1c1
Sequence:CCGGCCTGGGTTACTAGGTGTCTTTCTCGAGAAAGACACCTAGTAACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001316.2-1469s1c1
Sequence:CCGGGCATGGAATTACACAAGCAAACTCGAGTTTGCTTGTGTAATTCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001316.2-2169s1c1
Sequence:CCGGCCGTCTTCCTATATGGCCTTACTCGAGTAAGGCCATATAGGAAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001316.2-614s1c1
Sequence:CCGGCCGTCATGAATTTAAGTCAAACTCGAGTTTGACTTAAATTCATGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001316.2-1150s1c1
Sequence:CCGGCGCTGACAAGTATCTGTGAAACTCGAGTTTCACAGATACTTGTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001316
VALIDATED
CSE1L MISSION shRNA Lentiviral Transduction Particles
CSE1 chromosome segregation 1-like (yeast)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001316.2-614s21c1
Sequence:CCGGCCGTCATGAATTTAAGTCAAACTCGAGTTTGACTTAAATTCATGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001316.2-1150s21c1
Sequence:CCGGCGCTGACAAGTATCTGTGAAACTCGAGTTTCACAGATACTTGTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001316.2-1469s21c1
Sequence:CCGGGCATGGAATTACACAAGCAAACTCGAGTTTGCTTGTGTAATTCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001316.2-2169s21c1
Sequence:CCGGCCGTCTTCCTATATGGCCTTACTCGAGTAAGGCCATATAGGAAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_001316.2-2316s1c1
Sequence:CCGGCCTGGGTTACTAGGTGTCTTTCTCGAGAAAGACACCTAGTAACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001316.2-1469s1c1
Sequence:CCGGGCATGGAATTACACAAGCAAACTCGAGTTTGCTTGTGTAATTCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001316.2-2169s1c1
Sequence:CCGGCCGTCTTCCTATATGGCCTTACTCGAGTAAGGCCATATAGGAAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001316.2-614s1c1
Sequence:CCGGCCGTCATGAATTTAAGTCAAACTCGAGTTTGACTTAAATTCATGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001316.2-1150s1c1
Sequence:CCGGCGCTGACAAGTATCTGTGAAACTCGAGTTTCACAGATACTTGTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023565
VALIDATED
CSE1L MISSION shRNA Bacterial Glycerol Stock
CSE1 chromosome segregation 1-like (yeast)
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000314481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023565.2-2440s21c1
Sequence:CCGGCCACCAAGTTTATCAAGAGTTCTCGAGAACTCTTGATAAACTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023565.2-2396s21c1
Sequence:CCGGGCAGATCTTCATTCTACTATTCTCGAGAATAGTAGAATGAAGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215594    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023565.2-3167s1c1
Sequence:CCGGGTTTGTCTTGATCATCAATATCTCGAGATATTGATGATCAAGACAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217479    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023565.2-351s1c1
Sequence:CCGGGCTGATCGAGTAGCTATTAAACTCGAGTTTAATAGCTACTCGATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023565.2-1950s21c1
Sequence:CCGGGAAGCAATATGCTTGTCTATACTCGAGTATAGACAAGCATATTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023565.2-1443s21c1
Sequence:CCGGGCCAATGAACTTGTAAACCTACTCGAGTAGGTTTACAAGTTCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023565.1-1438s1c1
Sequence:CCGGCGCAAGCCAATGAACTTGTAACTCGAGTTACAAGTTCATTGGCTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023565.1-1443s1c1
Sequence:CCGGGCCAATGAACTTGTAAACCTACTCGAGTAGGTTTACAAGTTCATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023565.1-2440s1c1
Sequence:CCGGCCACCAAGTTTATCAAGAGTTCTCGAGAACTCTTGATAAACTTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023565.1-2396s1c1
Sequence:CCGGGCAGATCTTCATTCTACTATTCTCGAGAATAGTAGAATGAAGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023565.1-1950s1c1
Sequence:CCGGGAAGCAATATGCTTGTCTATACTCGAGTATAGACAAGCATATTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193705    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023565.1-2957s1c1
Sequence:CCGGCTTGCAGTATCTCCAAGGTTACTCGAGTAACCTTGGAGATACTGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023565
VALIDATED
CSE1L MISSION shRNA shRNA Plasmid DNA
CSE1 chromosome segregation 1-like (yeast)
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000314481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023565.2-2440s21c1
Sequence:CCGGCCACCAAGTTTATCAAGAGTTCTCGAGAACTCTTGATAAACTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023565.2-2396s21c1
Sequence:CCGGGCAGATCTTCATTCTACTATTCTCGAGAATAGTAGAATGAAGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215594    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023565.2-3167s1c1
Sequence:CCGGGTTTGTCTTGATCATCAATATCTCGAGATATTGATGATCAAGACAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217479    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023565.2-351s1c1
Sequence:CCGGGCTGATCGAGTAGCTATTAAACTCGAGTTTAATAGCTACTCGATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023565.2-1950s21c1
Sequence:CCGGGAAGCAATATGCTTGTCTATACTCGAGTATAGACAAGCATATTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023565.2-1443s21c1
Sequence:CCGGGCCAATGAACTTGTAAACCTACTCGAGTAGGTTTACAAGTTCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023565.1-1438s1c1
Sequence:CCGGCGCAAGCCAATGAACTTGTAACTCGAGTTACAAGTTCATTGGCTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023565.1-1443s1c1
Sequence:CCGGGCCAATGAACTTGTAAACCTACTCGAGTAGGTTTACAAGTTCATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023565.1-2440s1c1
Sequence:CCGGCCACCAAGTTTATCAAGAGTTCTCGAGAACTCTTGATAAACTTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023565.1-2396s1c1
Sequence:CCGGGCAGATCTTCATTCTACTATTCTCGAGAATAGTAGAATGAAGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023565.1-1950s1c1
Sequence:CCGGGAAGCAATATGCTTGTCTATACTCGAGTATAGACAAGCATATTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193705    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023565.1-2957s1c1
Sequence:CCGGCTTGCAGTATCTCCAAGGTTACTCGAGTAACCTTGGAGATACTGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023565
VALIDATED
CSE1L MISSION shRNA Lentiviral Transduction Particles
CSE1 chromosome segregation 1-like (yeast)
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000314481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023565.2-2440s21c1
Sequence:CCGGCCACCAAGTTTATCAAGAGTTCTCGAGAACTCTTGATAAACTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023565.2-2396s21c1
Sequence:CCGGGCAGATCTTCATTCTACTATTCTCGAGAATAGTAGAATGAAGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215594    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023565.2-3167s1c1
Sequence:CCGGGTTTGTCTTGATCATCAATATCTCGAGATATTGATGATCAAGACAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217479    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023565.2-351s1c1
Sequence:CCGGGCTGATCGAGTAGCTATTAAACTCGAGTTTAATAGCTACTCGATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023565.2-1950s21c1
Sequence:CCGGGAAGCAATATGCTTGTCTATACTCGAGTATAGACAAGCATATTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023565.2-1443s21c1
Sequence:CCGGGCCAATGAACTTGTAAACCTACTCGAGTAGGTTTACAAGTTCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023565.1-1438s1c1
Sequence:CCGGCGCAAGCCAATGAACTTGTAACTCGAGTTACAAGTTCATTGGCTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023565.1-1443s1c1
Sequence:CCGGGCCAATGAACTTGTAAACCTACTCGAGTAGGTTTACAAGTTCATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023565.1-2440s1c1
Sequence:CCGGCCACCAAGTTTATCAAGAGTTCTCGAGAACTCTTGATAAACTTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023565.1-2396s1c1
Sequence:CCGGGCAGATCTTCATTCTACTATTCTCGAGAATAGTAGAATGAAGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023565.1-1950s1c1
Sequence:CCGGGAAGCAATATGCTTGTCTATACTCGAGTATAGACAAGCATATTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193705    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023565.1-2957s1c1
Sequence:CCGGCTTGCAGTATCTCCAAGGTTACTCGAGTAACCTTGGAGATACTGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks