EMAIL THIS PAGE TO A FRIEND

CSF1

colony stimulating factor 1 (macrophage)

221 Gene Product Result for
Synonyms: CSF-1 MCSF
Gene ID:
Human(1435) Summary: The protein encoded by this gene is a cytokine that controls the production, differentiation, and function of macrophages. The active form of the protein is found extracellularly as a disulfide-linked homodimer, and is thought to be produced by proteolytic cleavage of membrane-bound precursors. The encoded protein may be involved in development of the placenta. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2011]
Mouse(12977) colony stimulating factor 1 (macrophage)
Rat(78965) colony stimulating factor 1 (macrophage)
sheep(101104200) colony stimulating factor 1 (macrophage)
naked mole-rat(101709756) colony stimulating factor 1 (macrophage)
domestic guinea pig(100732898) colony stimulating factor 1 (macrophage)
chicken(100499189) colony-stimulating factor 1
dog(611795) colony stimulating factor 1 (macrophage)
domestic cat(101091467) colony stimulating factor 1 (macrophage)
cow(281094) colony stimulating factor 1 (macrophage)
Gene Class: Cytokines_and_Chemokines
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007778 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007778 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007778 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000757 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000757 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000757 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000757 Rosetta Predictions human pricing
NM_172210 Rosetta Predictions human pricing
NM_172211 Rosetta Predictions human pricing
NM_172212 Rosetta Predictions human pricing
NM_023981 Rosetta Predictions rat pricing
NM_001113529 Rosetta Predictions mouse pricing
NM_001113530 Rosetta Predictions mouse pricing
NM_007778 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000757 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00106102 predicted 692
2 SASI_Hs01_00106103 predicted 687
3 SASI_Hs01_00106104 predicted 660
4 SASI_Hs01_00106105 predicted 696
5 SASI_Hs01_00106106 predicted 693
6 SASI_Hs01_00106107 predicted 640
7 SASI_Hs01_00106108 predicted 688
8 SASI_Hs01_00106109 predicted 649
9 SASI_Hs01_00106110 predicted 660
10 SASI_Hs01_00106111 predicted 660
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172210 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185348 predicted 686
2 SASI_Hs01_00185349 predicted 689
3 SASI_Hs01_00185350 predicted 664
4 SASI_Hs01_00185351 predicted 699
5 SASI_Hs01_00185352 predicted 694
6 SASI_Hs01_00185353 predicted 639
7 SASI_Hs01_00185354 predicted 690
8 SASI_Hs01_00185355 predicted 643
9 SASI_Hs01_00185356 predicted 659
10 SASI_Hs01_00185357 predicted 659
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172211 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00147242 predicted 691
2 SASI_Hs01_00147243 predicted 692
3 SASI_Hs01_00147244 predicted 661
4 SASI_Hs01_00147245 predicted 698
5 SASI_Hs01_00147246 predicted 689
6 SASI_Hs01_00147247 predicted 640
7 SASI_Hs01_00147248 predicted 694
8 SASI_Hs01_00147249 predicted 649
9 SASI_Hs01_00147250 predicted 658
10 SASI_Hs01_00147251 predicted 653
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172212 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00135479 predicted 688
2 SASI_Hs01_00135480 predicted 693
3 SASI_Hs01_00135481 predicted 665
4 SASI_Hs01_00135482 predicted 695
5 SASI_Hs01_00135483 predicted 692
6 SASI_Hs01_00135484 predicted 639
7 SASI_Hs01_00135485 predicted 685
8 SASI_Hs01_00135486 predicted 643
9 SASI_Hs01_00135487 predicted 666
10 SASI_Hs01_00135488 predicted 661
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023981 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00122217 predicted 1035
2 SASI_Rn02_00263804 predicted 663
3 SASI_Rn01_00122218 predicted 1903
4 SASI_Rn01_00122219 predicted 1196
5 SASI_Rn01_00122220 predicted 342
6 SASI_Rn01_00122221 predicted 678
7 SASI_Rn01_00122222 predicted 1889
8 SASI_Rn01_00122223 predicted 807
9 SASI_Rn01_00122225 predicted 395
10 SASI_Rn01_00122226 predicted 1008
11 SASI_Rn01_00122224 predicted 1052
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113529 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00308073 predicted 592
2 SASI_Mm02_00308074 predicted 629
3 SASI_Mm02_00308075 predicted 595
4 SASI_Mm02_00308076 predicted 524
5 SASI_Mm02_00308077 predicted 477
6 SASI_Mm02_00308078 predicted 619
7 SASI_Mm02_00308079 predicted 679
8 SASI_Mm02_00308080 predicted 499
9 SASI_Mm02_00308081 predicted 625
10 SASI_Mm02_00308082 predicted 581
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113530 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00308083 predicted 588
2 SASI_Mm02_00308084 predicted 630
3 SASI_Mm02_00308085 predicted 593
4 SASI_Mm02_00308086 predicted 517
5 SASI_Mm02_00308087 predicted 473
6 SASI_Mm02_00308088 predicted 620
7 SASI_Mm02_00308089 predicted 686
8 SASI_Mm02_00308090 predicted 496
9 SASI_Mm02_00308091 predicted 629
10 SASI_Mm02_00308092 predicted 581
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007778 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00107761 predicted 593
2 SASI_Mm02_00312425 predicted 621
3 SASI_Mm02_00312426 predicted 597
4 SASI_Mm02_00312427 predicted 524
5 SASI_Mm02_00312428 predicted 476
6 SASI_Mm02_00312429 predicted 618
7 SASI_Mm02_00312430 predicted 682
8 SASI_Mm02_00312431 predicted 497
9 SASI_Mm02_00312432 predicted 625
10 SASI_Mm02_00312433 predicted 578
11 SASI_Mm01_00107762 predicted 1298
12 SASI_Mm01_00107763 predicted 2087
13 SASI_Mm01_00107764 predicted 914
14 SASI_Mm01_00107765 predicted 1319
15 SASI_Mm01_00107766 predicted 1530
16 SASI_Mm01_00107767 predicted 1659
17 SASI_Mm01_00107768 predicted 1511
18 SASI_Mm01_00107769 predicted 850
19 SASI_Mm01_00107770 predicted 1912
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007778
VALIDATED
CSF1 MISSION shRNA Bacterial Glycerol Stock
colony stimulating factor 1 (macrophage)
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007778.1-1692s1c1
Sequence:CCGGCCTCCTGTTCTACAAGTGGAACTCGAGTTCCACTTGTAGAACAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007778.1-344s1c1
Sequence:CCGGCATGCCAGATTGCCTTTGAATCTCGAGATTCAAAGGCAATCTGGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065908    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007778.1-1940s1c1
Sequence:CCGGGCCTACCAAGACTGGATGAAACTCGAGTTTCATCCAGTCTTGGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007778.1-942s1c1
Sequence:CCGGCGAGTCAACAGAGCAACCAAACTCGAGTTTGGTTGCTCTGTTGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007778.1-1411s1c1
Sequence:CCGGGCTCAGTTACTGCTTCCCAAACTCGAGTTTGGGAAGCAGTAACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007778.1-1692s1c2
Sequence:CCGGCCTCCTGTTCTACAAGTGGAACTCGAGTTCCACTTGTAGAACAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007778.4-1939s21c1
Sequence:CCGGCCTCCTGTTCTACAAGTGGAACTCGAGTTCCACTTGTAGAACAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007778.4-686s21c1
Sequence:CCGGGATGAGACCATGCGCTTTAAACTCGAGTTTAAAGCGCATGGTCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007778.4-972s21c1
Sequence:CCGGGCAACTGCCTGTACCCTAAAGCTCGAGCTTTAGGGTACAGGCAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007778.4-634s21c1
Sequence:CCGGTGATCCTGTTTGCTACCTAAACTCGAGTTTAGGTAGCAAACAGGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324337    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007778.4-2187s21c1
Sequence:CCGGGCCTACCAAGACTGGATGAAACTCGAGTTTCATCCAGTCTTGGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007778
VALIDATED
CSF1 MISSION shRNA shRNA Plasmid DNA
colony stimulating factor 1 (macrophage)
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007778.1-1692s1c1
Sequence:CCGGCCTCCTGTTCTACAAGTGGAACTCGAGTTCCACTTGTAGAACAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007778.1-344s1c1
Sequence:CCGGCATGCCAGATTGCCTTTGAATCTCGAGATTCAAAGGCAATCTGGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065908    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007778.1-1940s1c1
Sequence:CCGGGCCTACCAAGACTGGATGAAACTCGAGTTTCATCCAGTCTTGGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007778.1-942s1c1
Sequence:CCGGCGAGTCAACAGAGCAACCAAACTCGAGTTTGGTTGCTCTGTTGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007778.1-1411s1c1
Sequence:CCGGGCTCAGTTACTGCTTCCCAAACTCGAGTTTGGGAAGCAGTAACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007778.1-1692s1c2
Sequence:CCGGCCTCCTGTTCTACAAGTGGAACTCGAGTTCCACTTGTAGAACAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007778.4-1939s21c1
Sequence:CCGGCCTCCTGTTCTACAAGTGGAACTCGAGTTCCACTTGTAGAACAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007778.4-686s21c1
Sequence:CCGGGATGAGACCATGCGCTTTAAACTCGAGTTTAAAGCGCATGGTCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007778.4-972s21c1
Sequence:CCGGGCAACTGCCTGTACCCTAAAGCTCGAGCTTTAGGGTACAGGCAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007778.4-634s21c1
Sequence:CCGGTGATCCTGTTTGCTACCTAAACTCGAGTTTAGGTAGCAAACAGGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324337    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007778.4-2187s21c1
Sequence:CCGGGCCTACCAAGACTGGATGAAACTCGAGTTTCATCCAGTCTTGGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007778
VALIDATED
CSF1 MISSION shRNA Lentiviral Transduction Particles
colony stimulating factor 1 (macrophage)
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007778.1-1692s1c1
Sequence:CCGGCCTCCTGTTCTACAAGTGGAACTCGAGTTCCACTTGTAGAACAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007778.1-344s1c1
Sequence:CCGGCATGCCAGATTGCCTTTGAATCTCGAGATTCAAAGGCAATCTGGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065908    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007778.1-1940s1c1
Sequence:CCGGGCCTACCAAGACTGGATGAAACTCGAGTTTCATCCAGTCTTGGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007778.1-942s1c1
Sequence:CCGGCGAGTCAACAGAGCAACCAAACTCGAGTTTGGTTGCTCTGTTGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007778.1-1411s1c1
Sequence:CCGGGCTCAGTTACTGCTTCCCAAACTCGAGTTTGGGAAGCAGTAACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007778.1-1692s1c2
Sequence:CCGGCCTCCTGTTCTACAAGTGGAACTCGAGTTCCACTTGTAGAACAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007778.4-1939s21c1
Sequence:CCGGCCTCCTGTTCTACAAGTGGAACTCGAGTTCCACTTGTAGAACAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007778.4-686s21c1
Sequence:CCGGGATGAGACCATGCGCTTTAAACTCGAGTTTAAAGCGCATGGTCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007778.4-972s21c1
Sequence:CCGGGCAACTGCCTGTACCCTAAAGCTCGAGCTTTAGGGTACAGGCAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007778.4-634s21c1
Sequence:CCGGTGATCCTGTTTGCTACCTAAACTCGAGTTTAGGTAGCAAACAGGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324337    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007778.4-2187s21c1
Sequence:CCGGGCCTACCAAGACTGGATGAAACTCGAGTTTCATCCAGTCTTGGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000757
VALIDATED
CSF1 MISSION shRNA Bacterial Glycerol Stock
colony stimulating factor 1 (macrophage)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058558    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000757.3-2078s1c1
Sequence:CCGGCCACTATTTATTGTGAGCCCTCTCGAGAGGGCTCACAATAAATAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000757.3-374s1c1
Sequence:CCGGCGTGCCAAATTACATTTGAGTCTCGAGACTCAAATGTAATTTGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000757.3-1064s1c1
Sequence:CCGGAGGATATTCTTGACTCTGCAACTCGAGTTGCAGAGTCAAGAATATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000757.3-1612s1c1
Sequence:CCGGCCTTTGACTGACACAGGCCATCTCGAGATGGCCTGTGTCAGTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_000757.4-671s21c1
Sequence:CCGGTCTCCTGGTACAAGACATAATCTCGAGATTATGTCTTGTACCAGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262774    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000757.4-2589s21c1
Sequence:CCGGGTCGGCCTGATTTCCCGTAAACTCGAGTTTACGGGAAATCAGGCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000757.4-892s21c1
Sequence:CCGGTTGACAAGGACTGGAATATTTCTCGAGAAATATTCCAGTCCTTGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000757.4-523s21c1
Sequence:CCGGAGTACTGTAGCCACATGATTGCTCGAGCAATCATGTGGCTACAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000757.4-641s21c1
Sequence:CCGGAGATCCAGTGTGCTACCTTAACTCGAGTTAAGGTAGCACACTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000757
VALIDATED
CSF1 MISSION shRNA shRNA Plasmid DNA
colony stimulating factor 1 (macrophage)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058558    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000757.3-2078s1c1
Sequence:CCGGCCACTATTTATTGTGAGCCCTCTCGAGAGGGCTCACAATAAATAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000757.3-374s1c1
Sequence:CCGGCGTGCCAAATTACATTTGAGTCTCGAGACTCAAATGTAATTTGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000757.3-1064s1c1
Sequence:CCGGAGGATATTCTTGACTCTGCAACTCGAGTTGCAGAGTCAAGAATATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000757.3-1612s1c1
Sequence:CCGGCCTTTGACTGACACAGGCCATCTCGAGATGGCCTGTGTCAGTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_000757.4-671s21c1
Sequence:CCGGTCTCCTGGTACAAGACATAATCTCGAGATTATGTCTTGTACCAGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262774    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000757.4-2589s21c1
Sequence:CCGGGTCGGCCTGATTTCCCGTAAACTCGAGTTTACGGGAAATCAGGCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000757.4-892s21c1
Sequence:CCGGTTGACAAGGACTGGAATATTTCTCGAGAAATATTCCAGTCCTTGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000757.4-523s21c1
Sequence:CCGGAGTACTGTAGCCACATGATTGCTCGAGCAATCATGTGGCTACAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000757.4-641s21c1
Sequence:CCGGAGATCCAGTGTGCTACCTTAACTCGAGTTAAGGTAGCACACTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000757
VALIDATED
CSF1 MISSION shRNA Lentiviral Transduction Particles
colony stimulating factor 1 (macrophage)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058558    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000757.3-2078s1c1
Sequence:CCGGCCACTATTTATTGTGAGCCCTCTCGAGAGGGCTCACAATAAATAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000757.3-374s1c1
Sequence:CCGGCGTGCCAAATTACATTTGAGTCTCGAGACTCAAATGTAATTTGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000757.3-1064s1c1
Sequence:CCGGAGGATATTCTTGACTCTGCAACTCGAGTTGCAGAGTCAAGAATATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000757.3-1612s1c1
Sequence:CCGGCCTTTGACTGACACAGGCCATCTCGAGATGGCCTGTGTCAGTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_000757.4-671s21c1
Sequence:CCGGTCTCCTGGTACAAGACATAATCTCGAGATTATGTCTTGTACCAGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262774    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000757.4-2589s21c1
Sequence:CCGGGTCGGCCTGATTTCCCGTAAACTCGAGTTTACGGGAAATCAGGCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000757.4-892s21c1
Sequence:CCGGTTGACAAGGACTGGAATATTTCTCGAGAAATATTCCAGTCCTTGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000757.4-523s21c1
Sequence:CCGGAGTACTGTAGCCACATGATTGCTCGAGCAATCATGTGGCTACAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000757.4-641s21c1
Sequence:CCGGAGATCCAGTGTGCTACCTTAACTCGAGTTAAGGTAGCACACTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks