EMAIL THIS PAGE TO A FRIEND

CSF1R

colony stimulating factor 1 receptor

116 Gene Product Result for
Synonyms: C-FMS CD115 CSF-1R CSFR FIM2 FMS HDLS M-CSF-R
UniProtKB ID: P07333, D3DQG2, Q6LDW5, Q6LDY4, Q86VW7
Gene ID:
Human(1436) Summary: The protein encoded by this gene is the receptor for colony stimulating factor 1, a cytokine which controls the production, differentiation, and function of macrophages. This receptor mediates most if not all of the biological effects of this cytokine. Ligand binding activates the receptor kinase through a process of oligomerization and transphosphorylation. The encoded protein is a tyrosine kinase transmembrane receptor and member of the CSF1/PDGF receptor family of tyrosine-protein kinases. Mutations in this gene have been associated with a predisposition to myeloid malignancy. The first intron of this gene contains a transcriptionally inactive ribosomal protein L7 processed pseudogene oriented in the opposite direction. [provided by RefSeq, Jul 2008]
Mouse(12978) colony stimulating factor 1 receptor
Rat(307403) colony stimulating factor 1 receptor
chicken(396406) colony stimulating factor 1 receptor
dog(489188) colony stimulating factor 1 receptor
cow(509418) colony stimulating factor 1 receptor
Horse(100060422) colony stimulating factor 1 receptor
domestic cat(493706) colony stimulating factor 1 receptor
domestic guinea pig(100726053) colony stimulating factor 1 receptor
naked mole-rat(101719513) colony stimulating factor 1 receptor
sheep(101109969) colony stimulating factor 1 receptor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB5500088 Anti-CSF-1R antibody, Rabbit monoclonal recombinant, expressed in proprietary host, clone SP211, affinity isolated antibody human (tested)
immunohistochemistry pricing
SAB2501977 Anti-CSF1R antibody produced in goat affinity isolated antibody, buffered aqueous solution human, rat, canine, bovine
ELISA, western blot pricing
SAB2501384 Anti-CSF1R antibody produced in goat affinity isolated antibody, buffered aqueous solution canine, mouse, human, rat
ELISA, western blot pricing
HPA012323 Anti-CSF1R antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4500500 Anti-CSFR antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunofluorescence, immunohistochemistry pricing
SAB4500499 Anti-CSFR, C-Terminal antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4500498 Anti-M-CSF Receptor antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
SAB4500497 Anti-M-CSF Receptor, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
M7934 Anti-Macrophage Colony Stimulating Factor Receptor antibody produced in goat affinity isolated antibody, lyophilized powder human
ELISA, flow cytometry, western blot pricing
SAB1302603 ANTI-MOUSE CSF1R (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse
western blot pricing
SAB4504152 Anti-phospho-CSFR (pTyr561) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4301257 Anti-phospho-CSFR (pTyr561) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
SAB4301389 Anti-phospho-CSFR (pTyr708) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB4504037 Anti-phospho-M-CSF Receptor (pTyr723) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4503936 Anti-phospho-M-CSF Receptor (pTyr809) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing
SAB4301406 Anti-phospho-M-CSF Receptor (pTyr809) antibody produced in rabbit affinity isolated antibody human
western blot pricing
WH0001436M1 Monoclonal Anti-CSF1R antibody produced in mouse clone 1G4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1403703 Monoclonal Anti-CSF1R antibody produced in mouse clone 3G12, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005211 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005211 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005211 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001037859 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001037859 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001037859 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007779 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007779 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007779 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005211 Rosetta Predictions human pricing
NM_001029901 Rosetta Predictions rat pricing
NM_001037859 Rosetta Predictions mouse pricing
NM_007779 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005211 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199624 predicted 2257
2 SASI_Hs01_00199625 predicted 2764
3 SASI_Hs02_00339185 predicted 1042
4 SASI_Hs01_00199626 predicted 1495
5 SASI_Hs01_00199627 predicted 2636
6 SASI_Hs01_00199628 predicted 1028
7 SASI_Hs01_00199629 predicted 503
8 SASI_Hs01_00199630 predicted 1081
9 SASI_Hs01_00199631 predicted 1038
10 SASI_Hs01_00199632 predicted 1154
11 SASI_Hs01_00199633 predicted 1464
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029901 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00109876 predicted 1142
2 SASI_Rn01_00109877 predicted 1828
3 SASI_Rn01_00109878 predicted 753
4 SASI_Rn01_00109879 predicted 624
5 SASI_Rn01_00109880 predicted 2531
6 SASI_Rn01_00109881 predicted 1681
7 SASI_Rn01_00109882 predicted 881
8 SASI_Rn02_00203464 predicted 832
9 SASI_Rn01_00109884 predicted 1560
10 SASI_Rn01_00109885 predicted 913
11 SASI_Rn01_00109883 predicted 1196
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037859 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00152096 predicted 1982
2 SASI_Mm02_00289471 predicted 1441
3 SASI_Mm02_00289472 predicted 1749
4 SASI_Mm02_00289473 predicted 2917
5 SASI_Mm02_00289474 predicted 854
6 SASI_Mm01_00152099 predicted 1342
7 SASI_Mm02_00289475 predicted 1504
8 SASI_Mm01_00152100 predicted 1370
9 SASI_Mm01_00152102 predicted 1023
10 SASI_Mm02_00289476 predicted 900
11 SASI_Mm01_00152094 predicted 972
12 SASI_Mm01_00152095 predicted 1959
13 SASI_Mm01_00152097 predicted 1064
14 SASI_Mm01_00152098 predicted 1929
15 SASI_Mm01_00152101 predicted 2005
16 SASI_Mm01_00152103 predicted 1166
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007779 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00034677 predicted 759
2 SASI_Mm01_00034678 predicted 1747
3 SASI_Mm01_00034679 predicted 1780
4 SASI_Mm01_00034680 predicted 857
5 SASI_Mm01_00034681 predicted 1723
6 SASI_Mm01_00034682 predicted 1139
7 SASI_Mm01_00034683 predicted 1167
8 SASI_Mm01_00034684 predicted 1805
9 SASI_Mm01_00034685 predicted 820
10 SASI_Mm01_00034686 predicted 956
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005211
CSF1R MISSION shRNA Bacterial Glycerol Stock
colony stimulating factor 1 receptor
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005211.3-3042s21c1
Sequence:CCGGACAGGAGAGAGCGGGACTATACTCGAGTATAGTCCCGCTCTCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005211.3-1893s21c1
Sequence:CCGGTGCTGCTATTGTACAAGTATACTCGAGTATACTTGTACAATAGCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005211.3-2873s21c1
Sequence:CCGGGTGAACAGCAAGTTCTATAAACTCGAGTTTATAGAACTTGCTGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355872    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005211.3-3460s21c1
Sequence:CCGGATGGTGTTGGCCTCGTGTTTGCTCGAGCAAACACGAGGCCAACACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005211.x-504s1c1
Sequence:CCGGCCAACAACGCTACCTTCCAAACTCGAGTTTGGAAGGTAGCGTTGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005211.x-1703s1c1
Sequence:CCGGCTGCTGACTGTTGAGACCTTACTCGAGTAAGGTCTCAACAGTCAGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001590    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005211.x-3534s1c1
Sequence:CCGGGACTGACTTTATGCCTATGAACTCGAGTTCATAGGCATAAAGTCAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005211.x-1020s1c1
Sequence:CCGGAGCTCGCAATCCCTCAACAATCTCGAGATTGTTGAGGGATTGCGAGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196973    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005211.2-3705s1c1
Sequence:CCGGGAATCTCACAGGACCTCTTAGCTCGAGCTAAGAGGTCCTGTGAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196346    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005211.2-1894s1c1
Sequence:CCGGGCTGCTATTGTACAAGTATAACTCGAGTTATACTTGTACAATAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005211
CSF1R MISSION shRNA shRNA Plasmid DNA
colony stimulating factor 1 receptor
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005211.3-3042s21c1
Sequence:CCGGACAGGAGAGAGCGGGACTATACTCGAGTATAGTCCCGCTCTCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005211.3-1893s21c1
Sequence:CCGGTGCTGCTATTGTACAAGTATACTCGAGTATACTTGTACAATAGCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005211.3-2873s21c1
Sequence:CCGGGTGAACAGCAAGTTCTATAAACTCGAGTTTATAGAACTTGCTGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355872    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005211.3-3460s21c1
Sequence:CCGGATGGTGTTGGCCTCGTGTTTGCTCGAGCAAACACGAGGCCAACACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005211.x-504s1c1
Sequence:CCGGCCAACAACGCTACCTTCCAAACTCGAGTTTGGAAGGTAGCGTTGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005211.x-1703s1c1
Sequence:CCGGCTGCTGACTGTTGAGACCTTACTCGAGTAAGGTCTCAACAGTCAGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001590    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005211.x-3534s1c1
Sequence:CCGGGACTGACTTTATGCCTATGAACTCGAGTTCATAGGCATAAAGTCAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005211.x-1020s1c1
Sequence:CCGGAGCTCGCAATCCCTCAACAATCTCGAGATTGTTGAGGGATTGCGAGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196973    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005211.2-3705s1c1
Sequence:CCGGGAATCTCACAGGACCTCTTAGCTCGAGCTAAGAGGTCCTGTGAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196346    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005211.2-1894s1c1
Sequence:CCGGGCTGCTATTGTACAAGTATAACTCGAGTTATACTTGTACAATAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005211
CSF1R MISSION shRNA Lentiviral Transduction Particles
colony stimulating factor 1 receptor
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005211.3-3042s21c1
Sequence:CCGGACAGGAGAGAGCGGGACTATACTCGAGTATAGTCCCGCTCTCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005211.3-1893s21c1
Sequence:CCGGTGCTGCTATTGTACAAGTATACTCGAGTATACTTGTACAATAGCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005211.3-2873s21c1
Sequence:CCGGGTGAACAGCAAGTTCTATAAACTCGAGTTTATAGAACTTGCTGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355872    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005211.3-3460s21c1
Sequence:CCGGATGGTGTTGGCCTCGTGTTTGCTCGAGCAAACACGAGGCCAACACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005211.x-504s1c1
Sequence:CCGGCCAACAACGCTACCTTCCAAACTCGAGTTTGGAAGGTAGCGTTGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005211.x-1703s1c1
Sequence:CCGGCTGCTGACTGTTGAGACCTTACTCGAGTAAGGTCTCAACAGTCAGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001590    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005211.x-3534s1c1
Sequence:CCGGGACTGACTTTATGCCTATGAACTCGAGTTCATAGGCATAAAGTCAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005211.x-1020s1c1
Sequence:CCGGAGCTCGCAATCCCTCAACAATCTCGAGATTGTTGAGGGATTGCGAGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196973    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005211.2-3705s1c1
Sequence:CCGGGAATCTCACAGGACCTCTTAGCTCGAGCTAAGAGGTCCTGTGAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196346    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005211.2-1894s1c1
Sequence:CCGGGCTGCTATTGTACAAGTATAACTCGAGTTATACTTGTACAATAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001037859
VALIDATED
CSF1R MISSION shRNA Bacterial Glycerol Stock
colony stimulating factor 1 receptor
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000321848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037859.2-1371s21c1
Sequence:CCGGGCTCTTTCTGAACCGTGTAAACTCGAGTTTACACGGTTCAGAAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321788    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001037859.2-3516s21c1
Sequence:CCGGTCAATGGAAAGACTGATTTATCTCGAGATAAATCAGTCTTTCCATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001037859.2-1091s21c1
Sequence:CCGGTCCAAGACGCTGGCATATATTCTCGAGAATATATGCCAGCGTCTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001037859.2-1972s21c1
Sequence:CCGGCCTACTCAGTTGCCCTACAATCTCGAGATTGTAGGGCAACTGAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001037859.2-818s21c1
Sequence:CCGGCCATGGTGAATGGTAGGGAATCTCGAGATTCCCTACCATTCACCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001037859
VALIDATED
CSF1R MISSION shRNA shRNA Plasmid DNA
colony stimulating factor 1 receptor
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000321848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037859.2-1371s21c1
Sequence:CCGGGCTCTTTCTGAACCGTGTAAACTCGAGTTTACACGGTTCAGAAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321788    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001037859.2-3516s21c1
Sequence:CCGGTCAATGGAAAGACTGATTTATCTCGAGATAAATCAGTCTTTCCATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001037859.2-1091s21c1
Sequence:CCGGTCCAAGACGCTGGCATATATTCTCGAGAATATATGCCAGCGTCTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001037859.2-1972s21c1
Sequence:CCGGCCTACTCAGTTGCCCTACAATCTCGAGATTGTAGGGCAACTGAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001037859.2-818s21c1
Sequence:CCGGCCATGGTGAATGGTAGGGAATCTCGAGATTCCCTACCATTCACCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001037859
VALIDATED
CSF1R MISSION shRNA Lentiviral Transduction Particles
colony stimulating factor 1 receptor
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000321848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037859.2-1371s21c1
Sequence:CCGGGCTCTTTCTGAACCGTGTAAACTCGAGTTTACACGGTTCAGAAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321788    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001037859.2-3516s21c1
Sequence:CCGGTCAATGGAAAGACTGATTTATCTCGAGATAAATCAGTCTTTCCATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001037859.2-1091s21c1
Sequence:CCGGTCCAAGACGCTGGCATATATTCTCGAGAATATATGCCAGCGTCTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001037859.2-1972s21c1
Sequence:CCGGCCTACTCAGTTGCCCTACAATCTCGAGATTGTAGGGCAACTGAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001037859.2-818s21c1
Sequence:CCGGCCATGGTGAATGGTAGGGAATCTCGAGATTCCCTACCATTCACCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007779
VALIDATED
CSF1R MISSION shRNA Bacterial Glycerol Stock
colony stimulating factor 1 receptor
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000023659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007779.1-2697s1c1
Sequence:CCGGGCCTGTATTTGCACCGAAGAACTCGAGTTCTTCGGTGCAAATACAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007779.1-1164s1c1
Sequence:CCGGGCTCTTTCTGAACCGTGTAAACTCGAGTTTACACGGTTCAGAAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007779.1-1765s1c1
Sequence:CCGGCCTACTCAGTTGCCCTACAATCTCGAGATTGTAGGGCAACTGAGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007779.1-1998s1c1
Sequence:CCGGCGAGAATATAGTCAACCTCTTCTCGAGAAGAGGTTGACTATATTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007779.1-611s1c1
Sequence:CCGGCCATGGTGAATGGTAGGGAATCTCGAGATTCCCTACCATTCACCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007779
VALIDATED
CSF1R MISSION shRNA shRNA Plasmid DNA
colony stimulating factor 1 receptor
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000023659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007779.1-2697s1c1
Sequence:CCGGGCCTGTATTTGCACCGAAGAACTCGAGTTCTTCGGTGCAAATACAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007779.1-1164s1c1
Sequence:CCGGGCTCTTTCTGAACCGTGTAAACTCGAGTTTACACGGTTCAGAAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007779.1-1765s1c1
Sequence:CCGGCCTACTCAGTTGCCCTACAATCTCGAGATTGTAGGGCAACTGAGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007779.1-1998s1c1
Sequence:CCGGCGAGAATATAGTCAACCTCTTCTCGAGAAGAGGTTGACTATATTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007779.1-611s1c1
Sequence:CCGGCCATGGTGAATGGTAGGGAATCTCGAGATTCCCTACCATTCACCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007779
VALIDATED
CSF1R MISSION shRNA Lentiviral Transduction Particles
colony stimulating factor 1 receptor
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000023659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007779.1-2697s1c1
Sequence:CCGGGCCTGTATTTGCACCGAAGAACTCGAGTTCTTCGGTGCAAATACAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007779.1-1164s1c1
Sequence:CCGGGCTCTTTCTGAACCGTGTAAACTCGAGTTTACACGGTTCAGAAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007779.1-1765s1c1
Sequence:CCGGCCTACTCAGTTGCCCTACAATCTCGAGATTGTAGGGCAACTGAGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007779.1-1998s1c1
Sequence:CCGGCGAGAATATAGTCAACCTCTTCTCGAGAAGAGGTTGACTATATTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007779.1-611s1c1
Sequence:CCGGCCATGGTGAATGGTAGGGAATCTCGAGATTCCCTACCATTCACCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks