EMAIL THIS PAGE TO A FRIEND

CSF2

colony stimulating factor 2 (granulocyte-macrophage)

Synonyms: GMCSF
UniProtKB ID: P04141, Q14CE8, Q2VPI8, Q8NFI6
Gene ID:
Human(1437) Summary: The protein encoded by this gene is a cytokine that controls the production, differentiation, and function of granulocytes and macrophages. The active form of the protein is found extracellularly as a homodimer. This gene has been localized to a cluster of related genes at chromosome region 5q31, which is known to be associated with interstitial deletions in the 5q- syndrome and acute myelogenous leukemia. Other genes in the cluster include those encoding interleukins 4, 5, and 13. [provided by RefSeq, Jul 2008]
Mouse(12981) colony stimulating factor 2 (granulocyte-macrophage)
Rat(116630) colony stimulating factor 2 (granulocyte-macrophage)
chicken(416325) colony stimulating factor 2 (granulocyte-macrophage)
dog(403923) colony stimulating factor 2 (granulocyte-macrophage)
domestic cat(493805) colony stimulating factor 2 (granulocyte-macrophage)
cow(281095) colony stimulating factor 2 (granulocyte-macrophage)
domestic cat(101094153) colony stimulating factor 2 (granulocyte-macrophage)
sheep(443400) colony stimulating factor 2 (granulocyte-macrophage)
naked mole-rat(101724943) colony stimulating factor 2 (granulocyte-macrophage)
domestic guinea pig(100135508) colony stimulating factor 2 (granulocyte-macrophage)
Gene Class: Cytokines_and_Chemokines
96 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
C0497 Anti-CSF2 (43-55) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1410249 Anti-CSF2 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
HPA057404 Anti-CSF2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
HPA062006 Anti-CSF2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
GW20025F Anti-GM-CSF antibody produced in chicken affinity isolated antibody, buffered aqueous solution human, mouse, rat
ELISA, western blot pricing
G0907 Anti-Granulocyte-Macrophage Colony Stimulating Factor antibody produced in goat affinity isolated antibody, lyophilized powder rat
ELISA, western blot pricing
WH0001437M1 Monoclonal Anti-CSF2 antibody produced in mouse clone 2G9, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1408902 Monoclonal Anti-CSF2 antibody produced in mouse clone 2C5, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1408903 Monoclonal Anti-CSF2 antibody produced in mouse clone 1E12, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1403704 Monoclonal Anti-CSF2, (C-terminal) antibody produced in mouse clone 1D6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000758 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000758 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000758 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009969 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009969 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009969 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000758 Rosetta Predictions human pricing
XM_001074265 Rosetta Predictions rat pricing
XM_340799 Rosetta Predictions rat pricing
NM_009969 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000758 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117978 predicted 198
2 SASI_Hs01_00117979 predicted 362
3 SASI_Hs01_00117980 predicted 310
4 SASI_Hs01_00117981 predicted 381
5 SASI_Hs01_00117982 predicted 378
6 SASI_Hs01_00117983 predicted 224
7 SASI_Hs01_00117984 predicted 405
8 SASI_Hs01_00117985 predicted 390
9 SASI_Hs01_00117986 predicted 367
10 SASI_Hs01_00117987 predicted 383
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074265 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00345621 predicted 217
2 SASI_Rn02_00345622 predicted 212
3 SASI_Rn02_00345623 predicted 213
4 SASI_Rn02_00345624 predicted 208
5 SASI_Rn02_00345625 predicted 215
6 SASI_Rn02_00345626 predicted 407
7 SASI_Rn02_00345627 predicted 372
8 SASI_Rn02_00345628 predicted 352
9 SASI_Rn02_00345629 predicted 158
10 SASI_Rn02_00345630 predicted 158
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_340799 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00391899 predicted 216
2 SASI_Rn02_00391900 predicted 207
3 SASI_Rn02_00391901 predicted 206
4 SASI_Rn02_00391902 predicted 214
5 SASI_Rn02_00391903 predicted 212
6 SASI_Rn02_00391904 predicted 406
7 SASI_Rn02_00391905 predicted 374
8 SASI_Rn02_00391906 predicted 351
9 SASI_Rn02_00391907 predicted 151
10 SASI_Rn02_00391908 predicted 158
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009969 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00039208 predicted 460
2 SASI_Mm02_00317537 predicted 358
3 SASI_Mm01_00039211 predicted 498
4 SASI_Mm02_00317538 predicted 421
5 SASI_Mm02_00317539 predicted 427
6 SASI_Mm01_00039212 predicted 565
7 SASI_Mm02_00317540 predicted 309
8 SASI_Mm01_00039215 predicted 506
9 SASI_Mm02_00317541 predicted 443
10 SASI_Mm02_00317542 predicted 431
11 SASI_Mm01_00039209 predicted 316
12 SASI_Mm01_00039210 predicted 351
13 SASI_Mm01_00039213 predicted 297
14 SASI_Mm01_00039214 predicted 221
15 SASI_Mm01_00039216 predicted 284
16 SASI_Mm01_00039217 predicted 272
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000758
CSF2 MISSION shRNA Bacterial Glycerol Stock
colony stimulating factor 2 (granulocyte-macrophage)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000758.2-376s1c1
Sequence:CCGGCCCAGATTATCACCTTTGAAACTCGAGTTTCAAAGGTGATAATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000758.2-413s1c1
Sequence:CCGGGAAGGACTTTCTGCTTGTCATCTCGAGATGACAAGCAGAAAGTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000758.2-204s1c1
Sequence:CCGGGAAGTCATCTCAGAAATGTTTCTCGAGAAACATTTCTGAGATGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000758.2-186s1c1
Sequence:CCGGGAGATGAATGAAACAGTAGAACTCGAGTTCTACTGTTTCATTCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000758.2-372s1c1
Sequence:CCGGGCAACCCAGATTATCACCTTTCTCGAGAAAGGTGATAATCTGGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371973    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000758.2-526s21c1
Sequence:CCGGGAAACTCAGGATGGTCATCTTCTCGAGAAGATGACCATCCTGAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371974    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000758.2-497s21c1
Sequence:CCGGGGAGCTGCTCTCTCATGAAACCTCGAGGTTTCATGAGAGAGCAGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000758.2-318s21c1
Sequence:CCGGATGATGGCCAGCCACTACAAGCTCGAGCTTGTAGTGGCTGGCCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000758
CSF2 MISSION shRNA shRNA Plasmid DNA
colony stimulating factor 2 (granulocyte-macrophage)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000758.2-376s1c1
Sequence:CCGGCCCAGATTATCACCTTTGAAACTCGAGTTTCAAAGGTGATAATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000758.2-413s1c1
Sequence:CCGGGAAGGACTTTCTGCTTGTCATCTCGAGATGACAAGCAGAAAGTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000758.2-204s1c1
Sequence:CCGGGAAGTCATCTCAGAAATGTTTCTCGAGAAACATTTCTGAGATGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000758.2-186s1c1
Sequence:CCGGGAGATGAATGAAACAGTAGAACTCGAGTTCTACTGTTTCATTCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000758.2-372s1c1
Sequence:CCGGGCAACCCAGATTATCACCTTTCTCGAGAAAGGTGATAATCTGGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371973    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000758.2-526s21c1
Sequence:CCGGGAAACTCAGGATGGTCATCTTCTCGAGAAGATGACCATCCTGAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371974    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000758.2-497s21c1
Sequence:CCGGGGAGCTGCTCTCTCATGAAACCTCGAGGTTTCATGAGAGAGCAGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000758.2-318s21c1
Sequence:CCGGATGATGGCCAGCCACTACAAGCTCGAGCTTGTAGTGGCTGGCCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000758
CSF2 MISSION shRNA Lentiviral Transduction Particles
colony stimulating factor 2 (granulocyte-macrophage)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000758.2-376s1c1
Sequence:CCGGCCCAGATTATCACCTTTGAAACTCGAGTTTCAAAGGTGATAATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000758.2-413s1c1
Sequence:CCGGGAAGGACTTTCTGCTTGTCATCTCGAGATGACAAGCAGAAAGTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000758.2-204s1c1
Sequence:CCGGGAAGTCATCTCAGAAATGTTTCTCGAGAAACATTTCTGAGATGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000758.2-186s1c1
Sequence:CCGGGAGATGAATGAAACAGTAGAACTCGAGTTCTACTGTTTCATTCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000758.2-372s1c1
Sequence:CCGGGCAACCCAGATTATCACCTTTCTCGAGAAAGGTGATAATCTGGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371973    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000758.2-526s21c1
Sequence:CCGGGAAACTCAGGATGGTCATCTTCTCGAGAAGATGACCATCCTGAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371974    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000758.2-497s21c1
Sequence:CCGGGGAGCTGCTCTCTCATGAAACCTCGAGGTTTCATGAGAGAGCAGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000758.2-318s21c1
Sequence:CCGGATGATGGCCAGCCACTACAAGCTCGAGCTTGTAGTGGCTGGCCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009969
VALIDATED
CSF2 MISSION shRNA Bacterial Glycerol Stock
colony stimulating factor 2 (granulocyte-macrophage)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009969.2-122s1c1
Sequence:CCGGGAAGCATGTAGAGGCCATCAACTCGAGTTGATGGCCTCTACATGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009969.2-170s1c1
Sequence:CCGGGCCTGTCACATTGAATGAAGACTCGAGTCTTCATTCAATGTGACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009969.2-314s1c1
Sequence:CCGGAGCCAGCTACTACCAGACATACTCGAGTATGTCTGGTAGTAGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009969.2-200s1c1
Sequence:CCGGCGTCTCTAACGAGTTCTCCTTCTCGAGAAGGAGAACTCGTTAGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009969.2-385s1c1
Sequence:CCGGCGGATTTCATAGACAGCCTTACTCGAGTAAGGCTGTCTATGAAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009969.4-571s21c1
Sequence:CCGGAGCCAGCTACTACCAGACATACTCGAGTATGTCTGGTAGTAGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009969.4-457s21c1
Sequence:CCGGCGTCTCTAACGAGTTCTCCTTCTCGAGAAGGAGAACTCGTTAGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009969.4-423s21c1
Sequence:CCGGACATGCCTGTCACGTTGAATGCTCGAGCATTCAACGTGACAGGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295109    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009969.4-775s21c1
Sequence:CCGGTGAGCCAGGAACTTGGAATTTCTCGAGAAATTCCAAGTTCCTGGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009969.4-642s21c1
Sequence:CCGGCGGATTTCATAGACAGCCTTACTCGAGTAAGGCTGTCTATGAAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009969
VALIDATED
CSF2 MISSION shRNA shRNA Plasmid DNA
colony stimulating factor 2 (granulocyte-macrophage)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009969.2-122s1c1
Sequence:CCGGGAAGCATGTAGAGGCCATCAACTCGAGTTGATGGCCTCTACATGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009969.2-170s1c1
Sequence:CCGGGCCTGTCACATTGAATGAAGACTCGAGTCTTCATTCAATGTGACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009969.2-314s1c1
Sequence:CCGGAGCCAGCTACTACCAGACATACTCGAGTATGTCTGGTAGTAGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009969.2-200s1c1
Sequence:CCGGCGTCTCTAACGAGTTCTCCTTCTCGAGAAGGAGAACTCGTTAGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009969.2-385s1c1
Sequence:CCGGCGGATTTCATAGACAGCCTTACTCGAGTAAGGCTGTCTATGAAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009969.4-571s21c1
Sequence:CCGGAGCCAGCTACTACCAGACATACTCGAGTATGTCTGGTAGTAGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009969.4-457s21c1
Sequence:CCGGCGTCTCTAACGAGTTCTCCTTCTCGAGAAGGAGAACTCGTTAGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009969.4-423s21c1
Sequence:CCGGACATGCCTGTCACGTTGAATGCTCGAGCATTCAACGTGACAGGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295109    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009969.4-775s21c1
Sequence:CCGGTGAGCCAGGAACTTGGAATTTCTCGAGAAATTCCAAGTTCCTGGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009969.4-642s21c1
Sequence:CCGGCGGATTTCATAGACAGCCTTACTCGAGTAAGGCTGTCTATGAAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009969
VALIDATED
CSF2 MISSION shRNA Lentiviral Transduction Particles
colony stimulating factor 2 (granulocyte-macrophage)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009969.2-122s1c1
Sequence:CCGGGAAGCATGTAGAGGCCATCAACTCGAGTTGATGGCCTCTACATGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009969.2-170s1c1
Sequence:CCGGGCCTGTCACATTGAATGAAGACTCGAGTCTTCATTCAATGTGACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009969.2-314s1c1
Sequence:CCGGAGCCAGCTACTACCAGACATACTCGAGTATGTCTGGTAGTAGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009969.2-200s1c1
Sequence:CCGGCGTCTCTAACGAGTTCTCCTTCTCGAGAAGGAGAACTCGTTAGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009969.2-385s1c1
Sequence:CCGGCGGATTTCATAGACAGCCTTACTCGAGTAAGGCTGTCTATGAAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009969.4-571s21c1
Sequence:CCGGAGCCAGCTACTACCAGACATACTCGAGTATGTCTGGTAGTAGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009969.4-457s21c1
Sequence:CCGGCGTCTCTAACGAGTTCTCCTTCTCGAGAAGGAGAACTCGTTAGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009969.4-423s21c1
Sequence:CCGGACATGCCTGTCACGTTGAATGCTCGAGCATTCAACGTGACAGGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295109    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009969.4-775s21c1
Sequence:CCGGTGAGCCAGGAACTTGGAATTTCTCGAGAAATTCCAAGTTCCTGGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009969.4-642s21c1
Sequence:CCGGCGGATTTCATAGACAGCCTTACTCGAGTAAGGCTGTCTATGAAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks