EMAIL THIS PAGE TO A FRIEND

CSF2RA

colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage)

150 Gene Product Result for
Synonyms: CD116 CDw116 CSF2R CSF2RAX CSF2RAY CSF2RX CSF2RY GM-CSF-R-alpha GMCSFR GMR SMDP4
Gene ID:
Human(1438) Summary: The protein encoded by this gene is the alpha subunit of the heterodimeric receptor for colony stimulating factor 2, a cytokine which controls the production, differentiation, and function of granulocytes and macrophages. The encoded protein is a member of the cytokine family of receptors. This gene is found in the pseudoautosomal region (PAR) of the X and Y chromosomes. Multiple transcript variants encoding different isoforms have been found for this gene, with some of the isoforms being membrane-bound and others being soluble. [provided by RefSeq, Jul 2008]
Mouse(12982) colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage)
Rat(652957) colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage)
sheep(101115509) colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage)
chicken(418667) colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage)
dog(609266) colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage)
cow(282207) colony stimulating factor 2 receptor, alpha
cow(511847) granulocyte-macrophage colony-stimulating factor receptor subunit alpha-like
domestic cat(101100621) colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006140 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006140 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006140 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009970 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009970 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009970 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006140 Rosetta Predictions human pricing
NM_172245 Rosetta Predictions human pricing
NM_172246 Rosetta Predictions human pricing
NM_172247 Rosetta Predictions human pricing
NM_172248 Rosetta Predictions human pricing
NM_172249 Rosetta Predictions human pricing
NM_001037660 Rosetta Predictions rat pricing
NM_009970 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006140 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081459 predicted 443
2 SASI_Hs01_00081460 predicted 461
3 SASI_Hs01_00081461 predicted 450
4 SASI_Hs01_00081462 predicted 500
5 SASI_Hs01_00081463 predicted 416
6 SASI_Hs01_00081464 predicted 491
7 SASI_Hs02_00340975 predicted 419
8 SASI_Hs01_00081465 predicted 570
9 SASI_Hs01_00081467 predicted 458
10 SASI_Hs01_00081468 predicted 413
11 SASI_Hs01_00081466 predicted 547
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172245 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00075314 predicted 424
2 SASI_Hs01_00075315 predicted 442
3 SASI_Hs01_00075316 predicted 428
4 SASI_Hs01_00075317 predicted 477
5 SASI_Hs01_00075318 predicted 385
6 SASI_Hs01_00075319 predicted 464
7 SASI_Hs02_00367958 predicted 392
8 SASI_Hs01_00075320 predicted 548
9 SASI_Hs01_00075322 predicted 429
10 SASI_Hs01_00075323 predicted 383
11 SASI_Hs01_00075321 predicted 529
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172246 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233024 predicted 441
2 SASI_Hs01_00233025 predicted 462
3 SASI_Hs01_00233026 predicted 456
4 SASI_Hs01_00233027 predicted 504
5 SASI_Hs01_00233028 predicted 410
6 SASI_Hs01_00233029 predicted 492
7 SASI_Hs02_00367959 predicted 419
8 SASI_Hs01_00233030 predicted 575
9 SASI_Hs01_00233032 predicted 456
10 SASI_Hs01_00233033 predicted 405
11 SASI_Hs01_00233031 predicted 551
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172247 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212051 predicted 285
2 SASI_Hs01_00212052 predicted 305
3 SASI_Hs01_00212053 predicted 289
4 SASI_Hs01_00212054 predicted 343
5 SASI_Hs01_00212055 predicted 250
6 SASI_Hs01_00212056 predicted 334
7 SASI_Hs02_00367960 predicted 263
8 SASI_Hs01_00212057 predicted 417
9 SASI_Hs01_00212059 predicted 300
10 SASI_Hs01_00212060 predicted 251
11 SASI_Hs01_00212058 predicted 393
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172248 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00201087 predicted 453
2 SASI_Hs01_00201088 predicted 475
3 SASI_Hs01_00201089 predicted 459
4 SASI_Hs01_00201090 predicted 503
5 SASI_Hs01_00201091 predicted 418
6 SASI_Hs01_00201092 predicted 498
7 SASI_Hs01_00201093 predicted 582
8 SASI_Hs01_00201094 predicted 556
9 SASI_Hs01_00201095 predicted 458
10 SASI_Hs01_00201096 predicted 411
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172249 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00102007 predicted 441
2 SASI_Hs01_00102008 predicted 463
3 SASI_Hs01_00102009 predicted 450
4 SASI_Hs01_00102010 predicted 497
5 SASI_Hs01_00102011 predicted 407
6 SASI_Hs01_00102012 predicted 491
7 SASI_Hs02_00367961 predicted 421
8 SASI_Hs01_00102013 predicted 573
9 SASI_Hs01_00102015 predicted 460
10 SASI_Hs01_00102016 predicted 409
11 SASI_Hs01_00102014 predicted 557
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037660 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00050486 predicted 769
2 SASI_Rn02_00204544 predicted 569
3 SASI_Rn01_00050487 predicted 763
4 SASI_Rn02_00204545 predicted 283
5 SASI_Rn01_00050488 predicted 211
6 SASI_Rn02_00204546 predicted 424
7 SASI_Rn01_00050489 predicted 655
8 SASI_Rn01_00050494 predicted 832
9 SASI_Rn01_00050495 predicted 1003
10 SASI_Rn02_00204547 predicted 826
11 SASI_Rn01_00050490 predicted 766
12 SASI_Rn01_00050491 predicted 433
13 SASI_Rn01_00050492 predicted 360
14 SASI_Rn01_00050493 predicted 786
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009970 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00317543 predicted 374
2 SASI_Mm02_00317544 predicted 1399
3 SASI_Mm02_00317545 predicted 1301
4 SASI_Mm02_00317546 predicted 548
5 SASI_Mm02_00317547 predicted 1173
6 SASI_Mm02_00317548 predicted 1206
7 SASI_Mm02_00317549 predicted 1444
8 SASI_Mm02_00317550 predicted 1470
9 SASI_Mm02_00317551 predicted 623
10 SASI_Mm02_00317552 predicted 765
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006140
CSF2RA MISSION shRNA Bacterial Glycerol Stock
colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006140.4-574s21c1
Sequence:CCGGTCATCTACAATGCGGATTTAACTCGAGTTAAATCCGCATTGTAGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006140.4-431s21c1
Sequence:CCGGTTCGTGCACATTTCGTGAAATCTCGAGATTTCACGAAATGTGCACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006140.4-746s21c1
Sequence:CCGGAGGATTAACGTCTCGCAATTACTCGAGTAATTGCGAGACGTTAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006140.3-779s1c1
Sequence:CCGGGCCGAGAAATTGGCATCCAATCTCGAGATTGGATGCCAATTTCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006140.3-1109s1c1
Sequence:CCGGCCTGGAGTGAAGCCATTGAATCTCGAGATTCAATGGCTTCACTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006140.3-1308s1c1
Sequence:CCGGCGAGATCATCTGGGAGGAATTCTCGAGAATTCCTCCCAGATGATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006140.3-401s1c1
Sequence:CCGGCCAGGCTCAGTAACAACGAATCTCGAGATTCGTTGTTACTGAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006140.3-676s1c1
Sequence:CCGGCGGTGTCCTTATTACATACAACTCGAGTTGTATGTAATAAGGACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006140
CSF2RA MISSION shRNA shRNA Plasmid DNA
colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006140.4-574s21c1
Sequence:CCGGTCATCTACAATGCGGATTTAACTCGAGTTAAATCCGCATTGTAGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006140.4-431s21c1
Sequence:CCGGTTCGTGCACATTTCGTGAAATCTCGAGATTTCACGAAATGTGCACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006140.4-746s21c1
Sequence:CCGGAGGATTAACGTCTCGCAATTACTCGAGTAATTGCGAGACGTTAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006140.3-779s1c1
Sequence:CCGGGCCGAGAAATTGGCATCCAATCTCGAGATTGGATGCCAATTTCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006140.3-1109s1c1
Sequence:CCGGCCTGGAGTGAAGCCATTGAATCTCGAGATTCAATGGCTTCACTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006140.3-1308s1c1
Sequence:CCGGCGAGATCATCTGGGAGGAATTCTCGAGAATTCCTCCCAGATGATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006140.3-401s1c1
Sequence:CCGGCCAGGCTCAGTAACAACGAATCTCGAGATTCGTTGTTACTGAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006140.3-676s1c1
Sequence:CCGGCGGTGTCCTTATTACATACAACTCGAGTTGTATGTAATAAGGACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006140
CSF2RA MISSION shRNA Lentiviral Transduction Particles
colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006140.4-574s21c1
Sequence:CCGGTCATCTACAATGCGGATTTAACTCGAGTTAAATCCGCATTGTAGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006140.4-431s21c1
Sequence:CCGGTTCGTGCACATTTCGTGAAATCTCGAGATTTCACGAAATGTGCACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006140.4-746s21c1
Sequence:CCGGAGGATTAACGTCTCGCAATTACTCGAGTAATTGCGAGACGTTAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006140.3-779s1c1
Sequence:CCGGGCCGAGAAATTGGCATCCAATCTCGAGATTGGATGCCAATTTCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006140.3-1109s1c1
Sequence:CCGGCCTGGAGTGAAGCCATTGAATCTCGAGATTCAATGGCTTCACTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006140.3-1308s1c1
Sequence:CCGGCGAGATCATCTGGGAGGAATTCTCGAGAATTCCTCCCAGATGATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006140.3-401s1c1
Sequence:CCGGCCAGGCTCAGTAACAACGAATCTCGAGATTCGTTGTTACTGAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006140.3-676s1c1
Sequence:CCGGCGGTGTCCTTATTACATACAACTCGAGTTGTATGTAATAAGGACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009970
CSF2RA MISSION shRNA Bacterial Glycerol Stock
colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009970.1-720s1c1
Sequence:CCGGCGCGTCCTGTAACTCTTCCCACTCGAGTGGGAAGAGTTACAGGACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009970.1-1006s1c1
Sequence:CCGGGCGCTCCTGTATGCAGTGACACTCGAGTGTCACTGCATACAGGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009970.1-1149s1c1
Sequence:CCGGGAACCCTGAGACCCTCAGGAACTCGAGTTCCTGAGGGTCTCAGGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009970.1-67s1c1
Sequence:CCGGGCCCTGCTCTTCTCCACGCTACTCGAGTAGCGTGGAGAAGAGCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009970.1-567s1c1
Sequence:CCGGCATCACACAGTGCATTGCGAACTCGAGTTCGCAATGCACTGTGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009970
CSF2RA MISSION shRNA shRNA Plasmid DNA
colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009970.1-720s1c1
Sequence:CCGGCGCGTCCTGTAACTCTTCCCACTCGAGTGGGAAGAGTTACAGGACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009970.1-1006s1c1
Sequence:CCGGGCGCTCCTGTATGCAGTGACACTCGAGTGTCACTGCATACAGGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009970.1-1149s1c1
Sequence:CCGGGAACCCTGAGACCCTCAGGAACTCGAGTTCCTGAGGGTCTCAGGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009970.1-67s1c1
Sequence:CCGGGCCCTGCTCTTCTCCACGCTACTCGAGTAGCGTGGAGAAGAGCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009970.1-567s1c1
Sequence:CCGGCATCACACAGTGCATTGCGAACTCGAGTTCGCAATGCACTGTGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009970
CSF2RA MISSION shRNA Lentiviral Transduction Particles
colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009970.1-720s1c1
Sequence:CCGGCGCGTCCTGTAACTCTTCCCACTCGAGTGGGAAGAGTTACAGGACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009970.1-1006s1c1
Sequence:CCGGGCGCTCCTGTATGCAGTGACACTCGAGTGTCACTGCATACAGGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009970.1-1149s1c1
Sequence:CCGGGAACCCTGAGACCCTCAGGAACTCGAGTTCCTGAGGGTCTCAGGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009970.1-67s1c1
Sequence:CCGGGCCCTGCTCTTCTCCACGCTACTCGAGTAGCGTGGAGAAGAGCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009970.1-567s1c1
Sequence:CCGGCATCACACAGTGCATTGCGAACTCGAGTTCGCAATGCACTGTGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks