EMAIL THIS PAGE TO A FRIEND

CSF2RB

colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage)

90 Gene Product Result for
Synonyms: CD131 CDw131 IL3RB IL5RB SMDP5
UniProtKB ID: P32927, Q5JZI1, Q6ICE0
Gene ID:
Human(1439) Summary: The protein encoded by this gene is the common beta chain of the high affinity receptor for IL-3, IL-5 and CSF. Defects in this gene have been reported to be associated with protein alveolar proteinosis (PAP). [provided by RefSeq, Jul 2008]
Mouse(12983) colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage)
Rat(171081) colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage)
Zebrafish(100135062) colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage)
chicken(771315) colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage)
dog(481276) colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage)
cow(528530) colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage)
domestic cat(101091636) colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage)
Horse(100054613) colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage)
sheep(101123199) colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage)
Domestic Rabbit(100349996) colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage)
domestic guinea pig(100192395) colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage)
naked mole-rat(101698831) colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007780 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007780 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007780 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000395 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000395 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000395 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000395 Rosetta Predictions human pricing
NM_133555 Rosetta Predictions rat pricing
NM_007780 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000395 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00011286 predicted 498
2 SASI_Hs02_00302468 predicted 429
3 SASI_Hs01_00011288 predicted 1165
4 SASI_Hs01_00011289 predicted 386
5 SASI_Hs02_00302469 predicted 1240
6 SASI_Hs01_00011290 predicted 2286
7 SASI_Hs01_00011291 predicted 1259
8 SASI_Hs01_00011293 predicted 2843
9 SASI_Hs01_00011294 predicted 1548
10 SASI_Hs01_00011295 predicted 1809
11 SASI_Hs01_00011287 predicted 1652
12 SASI_Hs01_00011292 predicted 1120
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133555 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00267744 predicted 1148
2 SASI_Rn01_00077845 predicted 337
3 SASI_Rn02_00267745 predicted 1863
4 SASI_Rn01_00077846 predicted 1551
5 SASI_Rn01_00077847 predicted 2272
6 SASI_Rn01_00077848 predicted 1116
7 SASI_Rn01_00077849 predicted 761
8 SASI_Rn01_00077850 predicted 677
9 SASI_Rn01_00077851 predicted 673
10 SASI_Rn01_00077852 predicted 686
11 SASI_Rn01_00077853 predicted 1501
12 SASI_Rn01_00077854 predicted 1768
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007780 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00312434 predicted 1357
2 SASI_Mm02_00312435 predicted 1436
3 SASI_Mm02_00312436 predicted 1346
4 SASI_Mm02_00312437 predicted 1159
5 SASI_Mm02_00312438 predicted 1351
6 SASI_Mm02_00312439 predicted 1991
7 SASI_Mm02_00312440 predicted 1981
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007780
CSF2RB MISSION shRNA Bacterial Glycerol Stock
colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007780.1-1465s1c1
Sequence:CCGGAGAACCTAGATCGAGCCCATACTCGAGTATGGGCTCGATCTAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007780.1-407s1c1
Sequence:CCGGCAATGACTACACCAACCACATCTCGAGATGTGGTTGGTGTAGTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007780.1-1580s1c1
Sequence:CCGGGAGCGAAGAGTACACTTGGAACTCGAGTTCCAAGTGTACTCTTCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007780.1-608s1c1
Sequence:CCGGCATCACAAACGAAGACTACTACTCGAGTAGTAGTCTTCGTTTGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007780.1-1393s1c1
Sequence:CCGGACTCATTCATTGAGCACACATCTCGAGATGTGTGCTCAATGAATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007780
CSF2RB MISSION shRNA shRNA Plasmid DNA
colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007780.1-1465s1c1
Sequence:CCGGAGAACCTAGATCGAGCCCATACTCGAGTATGGGCTCGATCTAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007780.1-407s1c1
Sequence:CCGGCAATGACTACACCAACCACATCTCGAGATGTGGTTGGTGTAGTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007780.1-1580s1c1
Sequence:CCGGGAGCGAAGAGTACACTTGGAACTCGAGTTCCAAGTGTACTCTTCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007780.1-608s1c1
Sequence:CCGGCATCACAAACGAAGACTACTACTCGAGTAGTAGTCTTCGTTTGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007780.1-1393s1c1
Sequence:CCGGACTCATTCATTGAGCACACATCTCGAGATGTGTGCTCAATGAATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007780
CSF2RB MISSION shRNA Lentiviral Transduction Particles
colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007780.1-1465s1c1
Sequence:CCGGAGAACCTAGATCGAGCCCATACTCGAGTATGGGCTCGATCTAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007780.1-407s1c1
Sequence:CCGGCAATGACTACACCAACCACATCTCGAGATGTGGTTGGTGTAGTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007780.1-1580s1c1
Sequence:CCGGGAGCGAAGAGTACACTTGGAACTCGAGTTCCAAGTGTACTCTTCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007780.1-608s1c1
Sequence:CCGGCATCACAAACGAAGACTACTACTCGAGTAGTAGTCTTCGTTTGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007780.1-1393s1c1
Sequence:CCGGACTCATTCATTGAGCACACATCTCGAGATGTGTGCTCAATGAATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000395
CSF2RB MISSION shRNA Bacterial Glycerol Stock
colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000395.1-2633s1c1
Sequence:CCGGCCCGTCATTCAGCTCTTCAAACTCGAGTTTGAAGAGCTGAATGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000395.1-1135s1c1
Sequence:CCGGCCACACATTTGAGATCCAGTACTCGAGTACTGGATCTCAAATGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000395.1-1778s1c1
Sequence:CCGGGCTTCCAGCTTTGACTTCAATCTCGAGATTGAAGTCAAAGCTGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000395.1-346s1c1
Sequence:CCGGTGACGTTGACTACTTCTCATTCTCGAGAATGAGAAGTAGTCAACGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000395.1-1124s1c1
Sequence:CCGGGAACACATAGACCACACATTTCTCGAGAAATGTGTGGTCTATGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000447098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000395.2-315s21c1
Sequence:CCGGTGCGCTGCTACAACGACTACACTCGAGTGTAGTCGTTGTAGCAGCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000395.2-1028s21c1
Sequence:CCGGTCGGTCTCCTTTGGCCTATTCCTCGAGGAATAGGCCAAAGGAGACCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412400    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000395.2-3153s21c1
Sequence:CCGGTTTGTAGGTTCTGCATTATTACTCGAGTAATAATGCAGAACCTACAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000395
CSF2RB MISSION shRNA shRNA Plasmid DNA
colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000395.1-2633s1c1
Sequence:CCGGCCCGTCATTCAGCTCTTCAAACTCGAGTTTGAAGAGCTGAATGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000395.1-1135s1c1
Sequence:CCGGCCACACATTTGAGATCCAGTACTCGAGTACTGGATCTCAAATGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000395.1-1778s1c1
Sequence:CCGGGCTTCCAGCTTTGACTTCAATCTCGAGATTGAAGTCAAAGCTGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000395.1-346s1c1
Sequence:CCGGTGACGTTGACTACTTCTCATTCTCGAGAATGAGAAGTAGTCAACGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000395.1-1124s1c1
Sequence:CCGGGAACACATAGACCACACATTTCTCGAGAAATGTGTGGTCTATGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000447098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000395.2-315s21c1
Sequence:CCGGTGCGCTGCTACAACGACTACACTCGAGTGTAGTCGTTGTAGCAGCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000395.2-1028s21c1
Sequence:CCGGTCGGTCTCCTTTGGCCTATTCCTCGAGGAATAGGCCAAAGGAGACCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412400    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000395.2-3153s21c1
Sequence:CCGGTTTGTAGGTTCTGCATTATTACTCGAGTAATAATGCAGAACCTACAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000395
CSF2RB MISSION shRNA Lentiviral Transduction Particles
colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000395.1-2633s1c1
Sequence:CCGGCCCGTCATTCAGCTCTTCAAACTCGAGTTTGAAGAGCTGAATGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000395.1-1135s1c1
Sequence:CCGGCCACACATTTGAGATCCAGTACTCGAGTACTGGATCTCAAATGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000395.1-1778s1c1
Sequence:CCGGGCTTCCAGCTTTGACTTCAATCTCGAGATTGAAGTCAAAGCTGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000395.1-346s1c1
Sequence:CCGGTGACGTTGACTACTTCTCATTCTCGAGAATGAGAAGTAGTCAACGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000395.1-1124s1c1
Sequence:CCGGGAACACATAGACCACACATTTCTCGAGAAATGTGTGGTCTATGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000447098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000395.2-315s21c1
Sequence:CCGGTGCGCTGCTACAACGACTACACTCGAGTGTAGTCGTTGTAGCAGCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000395.2-1028s21c1
Sequence:CCGGTCGGTCTCCTTTGGCCTATTCCTCGAGGAATAGGCCAAAGGAGACCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412400    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000395.2-3153s21c1
Sequence:CCGGTTTGTAGGTTCTGCATTATTACTCGAGTAATAATGCAGAACCTACAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks