EMAIL THIS PAGE TO A FRIEND

CSF3

colony stimulating factor 3 (granulocyte)

90 Gene Product Result for
Synonyms: C17orf33 CSF3OS GCSF
UniProtKB ID: P09919, A8MXR7
Gene ID:
Human(1440) Summary: The protein encoded by this gene is a cytokine that controls the production, differentiation, and function of granulocytes. The active protein is found extracellularly. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, May 2010]
Mouse(12985) colony stimulating factor 3 (granulocyte)
Rat(25610) colony stimulating factor 3 (granulocyte)
Zebrafish(100190920) CSF3 protein
chicken(396216) colony stimulating factor 3 (granulocyte)
Zebrafish(100270759) colony stimulating factor 3 (granulocyte)
cow(281096) colony stimulating factor 3 (granulocyte)
Horse(100033922) colony stimulating factor 3 (granulocyte)
domestic cat(493700) colony stimulating factor 3 (granulocyte)
dog(608246) colony stimulating factor 3 (granulocyte)
naked mole-rat(101698554) colony stimulating factor 3 (granulocyte)
domestic guinea pig(100729062) colony stimulating factor 3 (granulocyte)
Gene Class: Cytokines_and_Chemokines
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1405667 Anti-CSF3 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA001412 Anti-CSF3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
G4921 Anti-Granulocyte Colony Stimulating Factor antibody produced in goat affinity isolated antibody, lyophilized powder mouse
neutralization, western blot pricing
G5046 Anti-Granulocyte Colony Stimulating Factor antibody produced in goat affinity isolated antibody, lyophilized powder human
neutralization, western blot pricing
G5171 Anti-Granulocyte Colony Stimulating Factor antibody produced in goat IgG fraction of antiserum, lyophilized powder human
neutralization, western blot pricing
G5296 Anti-Granulocyte Colony Stimulating Factor antibody produced in goat IgG fraction of antiserum, lyophilized powder mouse
neutralization, western blot pricing
WH0001440M3 Monoclonal Anti-CSF3 antibody produced in mouse clone 2C5, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
G1029 Monoclonal Anti-Granulocyte Colony Stimulating Factor antibody produced in mouse clone 3316.111, purified immunoglobulin, lyophilized powder human
ELISA, neutralization pricing
G5421 Monoclonal Anti-Granulocyte Colony Stimulating Factor antibody produced in rat clone 67604, purified immunoglobulin, lyophilized powder mouse
ELISA, neutralization, western blot pricing
G0540 Monoclonal Anti-Granulotyte Colony Stimulating Factor antibody produced in rat clone 67604.111, purified immunoglobulin, lyophilized powder mouse
ELISA, neutralization, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009971 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009971 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009971 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000759 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000759 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000759 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU133971 MISSION® esiRNA esiRNA human CSF3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000759 Rosetta Predictions human pricing
NM_172219 Rosetta Predictions human pricing
NM_172220 Rosetta Predictions human pricing
NM_017104 Rosetta Predictions rat pricing
NM_009971 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000759 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00198429 predicted 679
2 SASI_Hs01_00198430 predicted 996
3 SASI_Hs01_00198431 predicted 467
4 SASI_Hs01_00198432 predicted 1001
5 SASI_Hs02_00303192 predicted 677
6 SASI_Hs01_00198433 predicted 701
7 SASI_Hs01_00198434 predicted 680
8 SASI_Hs01_00198435 predicted 856
9 SASI_Hs01_00198436 predicted 853
10 SASI_Hs01_00198438 predicted 716
11 SASI_Hs01_00198437 predicted 858
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172219 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00021390 predicted 666
2 SASI_Hs01_00021391 predicted 988
3 SASI_Hs01_00021392 predicted 459
4 SASI_Hs01_00021393 predicted 989
5 SASI_Hs02_00367933 predicted 666
6 SASI_Hs01_00021394 predicted 697
7 SASI_Hs01_00021395 predicted 670
8 SASI_Hs01_00021396 predicted 851
9 SASI_Hs01_00021397 predicted 842
10 SASI_Hs01_00021399 predicted 710
11 SASI_Hs01_00021398 predicted 849
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172220 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00198027 predicted 840
2 SASI_Hs01_00198028 predicted 1160
3 SASI_Hs01_00198029 predicted 637
4 SASI_Hs01_00198030 predicted 1167
5 SASI_Hs02_00367934 predicted 840
6 SASI_Hs01_00198031 predicted 874
7 SASI_Hs01_00198032 predicted 843
8 SASI_Hs01_00198033 predicted 1025
9 SASI_Hs01_00198034 predicted 1013
10 SASI_Hs01_00198036 predicted 886
11 SASI_Hs01_00198035 predicted 1026
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017104 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00102185 predicted 639
2 SASI_Rn01_00102186 predicted 820
3 SASI_Rn01_00102187 predicted 962
4 SASI_Rn01_00102189 predicted 719
5 SASI_Rn01_00102190 predicted 316
6 SASI_Rn01_00102191 predicted 1065
7 SASI_Rn02_00261334 predicted 1056
8 SASI_Rn01_00102192 predicted 413
9 SASI_Rn01_00102194 predicted 819
10 SASI_Rn02_00261335 predicted 902
11 SASI_Rn01_00102188 predicted 672
12 SASI_Rn01_00102193 predicted 457
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009971 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00094492 predicted 709
2 SASI_Mm01_00094494 predicted 887
3 SASI_Mm01_00094495 predicted 210
4 SASI_Mm01_00094496 predicted 781
5 SASI_Mm01_00094497 predicted 749
6 SASI_Mm01_00094498 predicted 742
7 SASI_Mm01_00094499 predicted 885
8 SASI_Mm01_00094500 predicted 476
9 SASI_Mm01_00094501 predicted 706
10 SASI_Mm02_00317553 predicted 740
11 SASI_Mm01_00094493 predicted 1045
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009971
CSF3 MISSION shRNA Bacterial Glycerol Stock
colony stimulating factor 3 (granulocyte)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009971.1-441s1c1
Sequence:CCGGTGCAGGCTCTATCGGGTATTTCTCGAGAAATACCCGATAGAGCCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009971.1-494s1c1
Sequence:CCGGCAGCTGGATGTTGCCAACTTTCTCGAGAAAGTTGGCAACATCCAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009971.1-225s1c1
Sequence:CCGGCCCTGGAGCAAGTGAGGAAGACTCGAGTCTTCCTCACTTGCTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009971.1-274s1c1
Sequence:CCGGGCAGTTGTGTGCCACCTACAACTCGAGTTGTAGGTGGCACACAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009971.1-628s1c1
Sequence:CCGGCCTGGCCATTTCGTACCTGCACTCGAGTGCAGGTACGAAATGGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009971
CSF3 MISSION shRNA shRNA Plasmid DNA
colony stimulating factor 3 (granulocyte)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009971.1-441s1c1
Sequence:CCGGTGCAGGCTCTATCGGGTATTTCTCGAGAAATACCCGATAGAGCCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009971.1-494s1c1
Sequence:CCGGCAGCTGGATGTTGCCAACTTTCTCGAGAAAGTTGGCAACATCCAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009971.1-225s1c1
Sequence:CCGGCCCTGGAGCAAGTGAGGAAGACTCGAGTCTTCCTCACTTGCTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009971.1-274s1c1
Sequence:CCGGGCAGTTGTGTGCCACCTACAACTCGAGTTGTAGGTGGCACACAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009971.1-628s1c1
Sequence:CCGGCCTGGCCATTTCGTACCTGCACTCGAGTGCAGGTACGAAATGGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009971
CSF3 MISSION shRNA Lentiviral Transduction Particles
colony stimulating factor 3 (granulocyte)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009971.1-441s1c1
Sequence:CCGGTGCAGGCTCTATCGGGTATTTCTCGAGAAATACCCGATAGAGCCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009971.1-494s1c1
Sequence:CCGGCAGCTGGATGTTGCCAACTTTCTCGAGAAAGTTGGCAACATCCAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009971.1-225s1c1
Sequence:CCGGCCCTGGAGCAAGTGAGGAAGACTCGAGTCTTCCTCACTTGCTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009971.1-274s1c1
Sequence:CCGGGCAGTTGTGTGCCACCTACAACTCGAGTTGTAGGTGGCACACAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009971.1-628s1c1
Sequence:CCGGCCTGGCCATTTCGTACCTGCACTCGAGTGCAGGTACGAAATGGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000759
CSF3 MISSION shRNA Bacterial Glycerol Stock
colony stimulating factor 3 (granulocyte)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000759.2-496s1c1
Sequence:CCGGGCAGATGGAAGAACTGGGAATCTCGAGATTCCCAGTTCTTCCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000759.2-623s1c1
Sequence:CCGGGAGGTGTCGTACCGCGTTCTACTCGAGTAGAACGCGGTACGACACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000759.2-286s1c1
Sequence:CCGGGCTCGGACACTCTCTGGGCATCTCGAGATGCCCAGAGAGTGTCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000759.2-366s1c1
Sequence:CCGGGCCAACTCCATAGCGGCCTTTCTCGAGAAAGGCCGCTATGGAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000759.2-180s1c1
Sequence:CCGGGCTTAGAGCAAGTGAGGAAGACTCGAGTCTTCCTCACTTGCTCTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371977    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000759.2-858s21c1
Sequence:CCGGGATAGGTAAATACCAAGTATTCTCGAGAATACTTGGTATTTACCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371978    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000759.2-711s21c1
Sequence:CCGGGTCTATTTAAGCCTCATATTTCTCGAGAAATATGAGGCTTAAATAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000759
CSF3 MISSION shRNA shRNA Plasmid DNA
colony stimulating factor 3 (granulocyte)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000759.2-496s1c1
Sequence:CCGGGCAGATGGAAGAACTGGGAATCTCGAGATTCCCAGTTCTTCCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000759.2-623s1c1
Sequence:CCGGGAGGTGTCGTACCGCGTTCTACTCGAGTAGAACGCGGTACGACACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000759.2-286s1c1
Sequence:CCGGGCTCGGACACTCTCTGGGCATCTCGAGATGCCCAGAGAGTGTCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000759.2-366s1c1
Sequence:CCGGGCCAACTCCATAGCGGCCTTTCTCGAGAAAGGCCGCTATGGAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000759.2-180s1c1
Sequence:CCGGGCTTAGAGCAAGTGAGGAAGACTCGAGTCTTCCTCACTTGCTCTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371977    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000759.2-858s21c1
Sequence:CCGGGATAGGTAAATACCAAGTATTCTCGAGAATACTTGGTATTTACCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371978    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000759.2-711s21c1
Sequence:CCGGGTCTATTTAAGCCTCATATTTCTCGAGAAATATGAGGCTTAAATAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000759
CSF3 MISSION shRNA Lentiviral Transduction Particles
colony stimulating factor 3 (granulocyte)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000759.2-496s1c1
Sequence:CCGGGCAGATGGAAGAACTGGGAATCTCGAGATTCCCAGTTCTTCCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000759.2-623s1c1
Sequence:CCGGGAGGTGTCGTACCGCGTTCTACTCGAGTAGAACGCGGTACGACACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000759.2-286s1c1
Sequence:CCGGGCTCGGACACTCTCTGGGCATCTCGAGATGCCCAGAGAGTGTCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000759.2-366s1c1
Sequence:CCGGGCCAACTCCATAGCGGCCTTTCTCGAGAAAGGCCGCTATGGAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000759.2-180s1c1
Sequence:CCGGGCTTAGAGCAAGTGAGGAAGACTCGAGTCTTCCTCACTTGCTCTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371977    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000759.2-858s21c1
Sequence:CCGGGATAGGTAAATACCAAGTATTCTCGAGAATACTTGGTATTTACCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371978    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000759.2-711s21c1
Sequence:CCGGGTCTATTTAAGCCTCATATTTCTCGAGAAATATGAGGCTTAAATAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks