EMAIL THIS PAGE TO A FRIEND

CSF3R

colony stimulating factor 3 receptor (granulocyte)

113 Gene Product Result for
Synonyms: CD114 GCSFR
UniProtKB ID: Q99062
Gene ID:
Human(1441) Summary: The protein encoded by this gene is the receptor for colony stimulating factor 3, a cytokine that controls the production, differentiation, and function of granulocytes. The encoded protein, which is a member of the family of cytokine receptors, may also function in some cell surface adhesion or recognition processes. Alternatively spliced transcript variants have been described. Mutations in this gene are a cause of Kostmann syndrome, also known as severe congenital neutropenia. [provided by RefSeq, Aug 2010]
Mouse(12986) colony stimulating factor 3 receptor (granulocyte)
Rat(298518) colony stimulating factor 3 receptor (granulocyte)
domestic guinea pig(100717194) colony stimulating factor 3 receptor (granulocyte)
naked mole-rat(101723599) colony stimulating factor 3 receptor (granulocyte)
sheep(101118070) colony stimulating factor 3 receptor (granulocyte)
Zebrafish(100134935) colony stimulating factor 3 receptor (granulocyte)
domestic cat(101089787) colony stimulating factor 3 receptor (granulocyte)
Horse(100069253) colony stimulating factor 3 receptor (granulocyte)
cow(281727) colony stimulating factor 3 receptor (granulocyte)
cow(511511) colony stimulating factor 3 receptor (granulocyte)
dog(607605) colony stimulating factor 3 receptor (granulocyte)
chicken(419620) colony stimulating factor 3 receptor (granulocyte)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000760 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000760 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000760 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007782 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007782 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007782 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000760 Rosetta Predictions human pricing
NM_156038 Rosetta Predictions human pricing
NM_156039 Rosetta Predictions human pricing
NM_172313 Rosetta Predictions human pricing
NM_001106685 Rosetta Predictions rat pricing
NM_007782 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000760 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00148222 predicted 827
2 SASI_Hs01_00148223 predicted 741
3 SASI_Hs01_00148225 predicted 1722
4 SASI_Hs01_00148226 predicted 1290
5 SASI_Hs01_00148227 predicted 753
6 SASI_Hs01_00148229 predicted 449
7 SASI_Hs01_00148231 predicted 1090
8 SASI_Hs02_00303193 predicted 548
9 SASI_Hs02_00303194 predicted 1284
10 SASI_Hs02_00303195 predicted 1438
11 SASI_Hs01_00148224 predicted 746
12 SASI_Hs01_00148228 predicted 1363
13 SASI_Hs01_00148230 predicted 1364
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_156038 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245132 predicted 828
2 SASI_Hs01_00245133 predicted 746
3 SASI_Hs01_00245135 predicted 1730
4 SASI_Hs01_00245136 predicted 1289
5 SASI_Hs01_00245137 predicted 753
6 SASI_Hs01_00245139 predicted 452
7 SASI_Hs01_00245141 predicted 1084
8 SASI_Hs02_00367538 predicted 547
9 SASI_Hs02_00367539 predicted 1282
10 SASI_Hs02_00367540 predicted 1442
11 SASI_Hs01_00245134 predicted 748
12 SASI_Hs01_00245138 predicted 1370
13 SASI_Hs01_00245140 predicted 1369
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_156039 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215497 predicted 821
2 SASI_Hs01_00215498 predicted 744
3 SASI_Hs01_00215500 predicted 1722
4 SASI_Hs01_00215501 predicted 1284
5 SASI_Hs01_00215502 predicted 749
6 SASI_Hs01_00215504 predicted 452
7 SASI_Hs01_00215506 predicted 1087
8 SASI_Hs02_00367541 predicted 550
9 SASI_Hs02_00367542 predicted 1280
10 SASI_Hs02_00367543 predicted 1441
11 SASI_Hs01_00215499 predicted 740
12 SASI_Hs01_00215503 predicted 1366
13 SASI_Hs01_00215505 predicted 1370
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172313 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104868 predicted 823
2 SASI_Hs01_00104869 predicted 738
3 SASI_Hs01_00104871 predicted 1722
4 SASI_Hs01_00104872 predicted 1285
5 SASI_Hs01_00104873 predicted 747
6 SASI_Hs01_00104875 predicted 449
7 SASI_Hs01_00104877 predicted 1092
8 SASI_Hs02_00367969 predicted 554
9 SASI_Hs02_00367970 predicted 1279
10 SASI_Hs02_00367971 predicted 1437
11 SASI_Hs01_00104870 predicted 746
12 SASI_Hs01_00104874 predicted 1363
13 SASI_Hs01_00104876 predicted 1365
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106685 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00221378 predicted 1946
2 SASI_Rn02_00221379 predicted 1584
3 SASI_Rn02_00221380 predicted 2602
4 SASI_Rn02_00221381 predicted 1068
5 SASI_Rn02_00221382 predicted 730
6 SASI_Rn02_00221383 predicted 2722
7 SASI_Rn02_00221384 predicted 2717
8 SASI_Rn02_00221385 predicted 2367
9 SASI_Rn02_00221386 predicted 1730
10 SASI_Rn02_00221387 predicted 2248
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007782 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00312441 predicted 1286
2 SASI_Mm02_00312442 predicted 1020
3 SASI_Mm02_00312443 predicted 2213
4 SASI_Mm02_00312444 predicted 1664
5 SASI_Mm02_00312445 predicted 413
6 SASI_Mm02_00312446 predicted 958
7 SASI_Mm02_00312447 predicted 2812
8 SASI_Mm02_00312448 predicted 2144
9 SASI_Mm02_00312449 predicted 1076
10 SASI_Mm02_00312450 predicted 1722
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000760
CSF3R MISSION shRNA Bacterial Glycerol Stock
colony stimulating factor 3 receptor (granulocyte)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000760.2-947s21c1
Sequence:CCGGCAGCCAGGCCTGCACATAAATCTCGAGATTTATGTGCAGGCCTGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000760.2-416s21c1
Sequence:CCGGGATGGGACCCAGGAATCTATCCTCGAGGATAGATTCCTGGGTCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000760.2-639s1c1
Sequence:CCGGCCAGCTTCACTCTGAAGAGTTCTCGAGAACTCTTCAGAGTGAAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000760.2-310s1c1
Sequence:CCGGCTCCTGCATCATCAAGCAGAACTCGAGTTCTGCTTGATGATGCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000760.2-752s1c1
Sequence:CCGGCACCTGCTGTTGTACCAGAATCTCGAGATTCTGGTACAACAGCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000760.2-1732s1c1
Sequence:CCGGCTATGCCTACTCTCAAGAAATCTCGAGATTTCTTGAGAGTAGGCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000760.2-2201s1c1
Sequence:CCGGCCCACAATCATGGAGGAGGATCTCGAGATCCTCCTCCATGATTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000760
CSF3R MISSION shRNA shRNA Plasmid DNA
colony stimulating factor 3 receptor (granulocyte)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000760.2-947s21c1
Sequence:CCGGCAGCCAGGCCTGCACATAAATCTCGAGATTTATGTGCAGGCCTGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000760.2-416s21c1
Sequence:CCGGGATGGGACCCAGGAATCTATCCTCGAGGATAGATTCCTGGGTCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000760.2-639s1c1
Sequence:CCGGCCAGCTTCACTCTGAAGAGTTCTCGAGAACTCTTCAGAGTGAAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000760.2-310s1c1
Sequence:CCGGCTCCTGCATCATCAAGCAGAACTCGAGTTCTGCTTGATGATGCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000760.2-752s1c1
Sequence:CCGGCACCTGCTGTTGTACCAGAATCTCGAGATTCTGGTACAACAGCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000760.2-1732s1c1
Sequence:CCGGCTATGCCTACTCTCAAGAAATCTCGAGATTTCTTGAGAGTAGGCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000760.2-2201s1c1
Sequence:CCGGCCCACAATCATGGAGGAGGATCTCGAGATCCTCCTCCATGATTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000760
CSF3R MISSION shRNA Lentiviral Transduction Particles
colony stimulating factor 3 receptor (granulocyte)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000760.2-947s21c1
Sequence:CCGGCAGCCAGGCCTGCACATAAATCTCGAGATTTATGTGCAGGCCTGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000760.2-416s21c1
Sequence:CCGGGATGGGACCCAGGAATCTATCCTCGAGGATAGATTCCTGGGTCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000760.2-639s1c1
Sequence:CCGGCCAGCTTCACTCTGAAGAGTTCTCGAGAACTCTTCAGAGTGAAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000760.2-310s1c1
Sequence:CCGGCTCCTGCATCATCAAGCAGAACTCGAGTTCTGCTTGATGATGCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000760.2-752s1c1
Sequence:CCGGCACCTGCTGTTGTACCAGAATCTCGAGATTCTGGTACAACAGCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000760.2-1732s1c1
Sequence:CCGGCTATGCCTACTCTCAAGAAATCTCGAGATTTCTTGAGAGTAGGCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000760.2-2201s1c1
Sequence:CCGGCCCACAATCATGGAGGAGGATCTCGAGATCCTCCTCCATGATTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007782
CSF3R MISSION shRNA Bacterial Glycerol Stock
colony stimulating factor 3 receptor (granulocyte)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007782.1-253s1c1
Sequence:CCGGGCTGTGGACACATCGAGATTTCTCGAGAAATCTCGATGTGTCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007782.1-1082s1c1
Sequence:CCGGCCCAGTCTACACCCTACAGATCTCGAGATCTGTAGGGTGTAGACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007782.1-525s1c1
Sequence:CCGGGCTGAGCTTCACGCAGGCTATCTCGAGATAGCCTGCGTGAAGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007782.1-206s1c1
Sequence:CCGGGACTGGAGTTACCCTGATCTTCTCGAGAAGATCAGGGTAACTCCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007782.1-2128s1c1
Sequence:CCGGGCAAACGCAGAGGAAAGACTTCTCGAGAAGTCTTTCCTCTGCGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007782
CSF3R MISSION shRNA shRNA Plasmid DNA
colony stimulating factor 3 receptor (granulocyte)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007782.1-253s1c1
Sequence:CCGGGCTGTGGACACATCGAGATTTCTCGAGAAATCTCGATGTGTCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007782.1-1082s1c1
Sequence:CCGGCCCAGTCTACACCCTACAGATCTCGAGATCTGTAGGGTGTAGACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007782.1-525s1c1
Sequence:CCGGGCTGAGCTTCACGCAGGCTATCTCGAGATAGCCTGCGTGAAGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007782.1-206s1c1
Sequence:CCGGGACTGGAGTTACCCTGATCTTCTCGAGAAGATCAGGGTAACTCCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007782.1-2128s1c1
Sequence:CCGGGCAAACGCAGAGGAAAGACTTCTCGAGAAGTCTTTCCTCTGCGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007782
CSF3R MISSION shRNA Lentiviral Transduction Particles
colony stimulating factor 3 receptor (granulocyte)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007782.1-253s1c1
Sequence:CCGGGCTGTGGACACATCGAGATTTCTCGAGAAATCTCGATGTGTCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007782.1-1082s1c1
Sequence:CCGGCCCAGTCTACACCCTACAGATCTCGAGATCTGTAGGGTGTAGACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007782.1-525s1c1
Sequence:CCGGGCTGAGCTTCACGCAGGCTATCTCGAGATAGCCTGCGTGAAGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007782.1-206s1c1
Sequence:CCGGGACTGGAGTTACCCTGATCTTCTCGAGAAGATCAGGGTAACTCCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007782.1-2128s1c1
Sequence:CCGGGCAAACGCAGAGGAAAGACTTCTCGAGAAGTCTTTCCTCTGCGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks