EMAIL THIS PAGE TO A FRIEND

CSGALNACT1

chondroitin sulfate N-acetylgalactosaminyltransferase 1

90 Gene Product Result for
Synonyms: CSGalNAcT-1 ChGn beta4GalNAcT
UniProtKB ID: Q8TDX6, B2RBE4, Q6P9G6, Q8IUF9, Q9NSQ7, Q9NUM9
Gene ID:
Mouse(234356) chondroitin sulfate N-acetylgalactosaminyltransferase 1
Rat(306375) chondroitin sulfate N-acetylgalactosaminyltransferase 1
chicken(422488) chondroitin sulfate N-acetylgalactosaminyltransferase 1
cow(528057) chondroitin sulfate N-acetylgalactosaminyltransferase 1
Horse(100052192) chondroitin sulfate N-acetylgalactosaminyltransferase 1
domestic cat(101096311) chondroitin sulfate N-acetylgalactosaminyltransferase 1
dog(482831) chondroitin sulfate N-acetylgalactosaminyltransferase 1
sheep(101120469) chondroitin sulfate N-acetylgalactosaminyltransferase 1
naked mole-rat(101700905) chondroitin sulfate N-acetylgalactosaminyltransferase 1
domestic guinea pig(100725703) chondroitin sulfate N-acetylgalactosaminyltransferase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172753 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172753 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172753 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018371 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018371 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018371 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018371 Rosetta Predictions human pricing
NM_001107309 Rosetta Predictions rat pricing
NM_172753 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018371 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00065460 predicted 1815
2 SASI_Hs01_00065461 predicted 1304
3 SASI_Hs01_00065462 predicted 722
4 SASI_Hs01_00065463 predicted 1905
5 SASI_Hs01_00065464 predicted 856
6 SASI_Hs01_00065465 predicted 1442
7 SASI_Hs01_00065466 predicted 2347
8 SASI_Hs01_00065467 predicted 1261
9 SASI_Hs01_00065468 predicted 1931
10 SASI_Hs01_00065469 predicted 1360
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107309 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227565 predicted 684
2 SASI_Rn02_00227566 predicted 1297
3 SASI_Rn02_00227567 predicted 1365
4 SASI_Rn02_00227568 predicted 769
5 SASI_Rn02_00227569 predicted 1431
6 SASI_Rn02_00227570 predicted 1635
7 SASI_Rn02_00227571 predicted 597
8 SASI_Rn02_00227572 predicted 1603
9 SASI_Rn02_00227573 predicted 1515
10 SASI_Rn02_00227574 predicted 1244
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172753 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00082145 predicted 1310
2 SASI_Mm01_00082146 predicted 2004
3 SASI_Mm01_00082147 predicted 1356
4 SASI_Mm02_00344605 predicted 725
5 SASI_Mm01_00082148 predicted 1567
6 SASI_Mm02_00344606 predicted 1575
7 SASI_Mm01_00082149 predicted 922
8 SASI_Mm01_00082150 predicted 835
9 SASI_Mm01_00082153 predicted 1527
10 SASI_Mm01_00082154 predicted 1471
11 SASI_Mm01_00082151 predicted 787
12 SASI_Mm01_00082152 predicted 1617
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172753
VALIDATED
CSGALNACT1 MISSION shRNA Bacterial Glycerol Stock
chondroitin sulfate N-acetylgalactosaminyltransferase 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110230    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172753.3-2996s1c1
Sequence:CCGGCCCGAGATAAACTTGAAATTACTCGAGTAATTTCAAGTTTATCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172753.3-2060s1c1
Sequence:CCGGCCGGAAATATCTCCATAGCAACTCGAGTTGCTATGGAGATATTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172753.3-897s1c1
Sequence:CCGGCAGCATCGTAACTATGTGAATCTCGAGATTCACATAGTTACGATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172753.3-1346s1c1
Sequence:CCGGCGAAAGGGATAAAGGCACTTTCTCGAGAAAGTGCCTTTATCCCTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172753.3-1986s1c1
Sequence:CCGGCGGTCAGACTTCATCAACATACTCGAGTATGTTGATGAAGTCTGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172753
VALIDATED
CSGALNACT1 MISSION shRNA shRNA Plasmid DNA
chondroitin sulfate N-acetylgalactosaminyltransferase 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110230    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172753.3-2996s1c1
Sequence:CCGGCCCGAGATAAACTTGAAATTACTCGAGTAATTTCAAGTTTATCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172753.3-2060s1c1
Sequence:CCGGCCGGAAATATCTCCATAGCAACTCGAGTTGCTATGGAGATATTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172753.3-897s1c1
Sequence:CCGGCAGCATCGTAACTATGTGAATCTCGAGATTCACATAGTTACGATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172753.3-1346s1c1
Sequence:CCGGCGAAAGGGATAAAGGCACTTTCTCGAGAAAGTGCCTTTATCCCTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172753.3-1986s1c1
Sequence:CCGGCGGTCAGACTTCATCAACATACTCGAGTATGTTGATGAAGTCTGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172753
VALIDATED
CSGALNACT1 MISSION shRNA Lentiviral Transduction Particles
chondroitin sulfate N-acetylgalactosaminyltransferase 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110230    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172753.3-2996s1c1
Sequence:CCGGCCCGAGATAAACTTGAAATTACTCGAGTAATTTCAAGTTTATCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172753.3-2060s1c1
Sequence:CCGGCCGGAAATATCTCCATAGCAACTCGAGTTGCTATGGAGATATTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172753.3-897s1c1
Sequence:CCGGCAGCATCGTAACTATGTGAATCTCGAGATTCACATAGTTACGATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172753.3-1346s1c1
Sequence:CCGGCGAAAGGGATAAAGGCACTTTCTCGAGAAAGTGCCTTTATCCCTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172753.3-1986s1c1
Sequence:CCGGCGGTCAGACTTCATCAACATACTCGAGTATGTTGATGAAGTCTGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018371
VALIDATED
CSGALNACT1 MISSION shRNA Bacterial Glycerol Stock
chondroitin sulfate N-acetylgalactosaminyltransferase 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000000316    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_018371.x-2980s1c1
Sequence:CCGGGACCGCTTTCTTACCTGTTTACTCGAGTAAACAGGTAAGAAAGCGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018371.x-1056s1c1
Sequence:CCGGGCTCATCTTATTTCGACCATTCTCGAGAATGGTCGAAATAAGATGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018371.x-1565s1c1
Sequence:CCGGAGCTGGTCATAAAGAAGGAAACTCGAGTTTCCTTCTTTATGACCAGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018371.x-411s1c1
Sequence:CCGGCTGTGCTATCTCTGTCCTGTACTCGAGTACAGGACAGAGATAGCACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018371.x-1638s1c1
Sequence:CCGGCTTCATCAATATAGGTGGGTTCTCGAGAACCCACCTATATTGATGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434697    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018371.4-2704s21c1
Sequence:CCGGGAGAGGAGATAGGCTTATTATCTCGAGATAATAAGCCTATCTCCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018371.4-1422s21c1
Sequence:CCGGCAACATGGCCAACACGCTTATCTCGAGATAAGCGTGTTGGCCATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018371.4-1533s21c1
Sequence:CCGGAGTCCATCTCACTGTTGTTTACTCGAGTAAACAACAGTGAGATGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018371.4-1260s21c1
Sequence:CCGGTCCTTACACGGCCTCTGATTTCTCGAGAAATCAGAGGCCGTGTAAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018371
VALIDATED
CSGALNACT1 MISSION shRNA shRNA Plasmid DNA
chondroitin sulfate N-acetylgalactosaminyltransferase 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000000316    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_018371.x-2980s1c1
Sequence:CCGGGACCGCTTTCTTACCTGTTTACTCGAGTAAACAGGTAAGAAAGCGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018371.x-1056s1c1
Sequence:CCGGGCTCATCTTATTTCGACCATTCTCGAGAATGGTCGAAATAAGATGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018371.x-1565s1c1
Sequence:CCGGAGCTGGTCATAAAGAAGGAAACTCGAGTTTCCTTCTTTATGACCAGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018371.x-411s1c1
Sequence:CCGGCTGTGCTATCTCTGTCCTGTACTCGAGTACAGGACAGAGATAGCACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018371.x-1638s1c1
Sequence:CCGGCTTCATCAATATAGGTGGGTTCTCGAGAACCCACCTATATTGATGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434697    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018371.4-2704s21c1
Sequence:CCGGGAGAGGAGATAGGCTTATTATCTCGAGATAATAAGCCTATCTCCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018371.4-1422s21c1
Sequence:CCGGCAACATGGCCAACACGCTTATCTCGAGATAAGCGTGTTGGCCATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018371.4-1533s21c1
Sequence:CCGGAGTCCATCTCACTGTTGTTTACTCGAGTAAACAACAGTGAGATGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018371.4-1260s21c1
Sequence:CCGGTCCTTACACGGCCTCTGATTTCTCGAGAAATCAGAGGCCGTGTAAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018371
VALIDATED
CSGALNACT1 MISSION shRNA Lentiviral Transduction Particles
chondroitin sulfate N-acetylgalactosaminyltransferase 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000000316    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_018371.x-2980s1c1
Sequence:CCGGGACCGCTTTCTTACCTGTTTACTCGAGTAAACAGGTAAGAAAGCGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018371.x-1056s1c1
Sequence:CCGGGCTCATCTTATTTCGACCATTCTCGAGAATGGTCGAAATAAGATGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018371.x-1565s1c1
Sequence:CCGGAGCTGGTCATAAAGAAGGAAACTCGAGTTTCCTTCTTTATGACCAGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018371.x-411s1c1
Sequence:CCGGCTGTGCTATCTCTGTCCTGTACTCGAGTACAGGACAGAGATAGCACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018371.x-1638s1c1
Sequence:CCGGCTTCATCAATATAGGTGGGTTCTCGAGAACCCACCTATATTGATGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434697    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018371.4-2704s21c1
Sequence:CCGGGAGAGGAGATAGGCTTATTATCTCGAGATAATAAGCCTATCTCCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018371.4-1422s21c1
Sequence:CCGGCAACATGGCCAACACGCTTATCTCGAGATAAGCGTGTTGGCCATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018371.4-1533s21c1
Sequence:CCGGAGTCCATCTCACTGTTGTTTACTCGAGTAAACAACAGTGAGATGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018371.4-1260s21c1
Sequence:CCGGTCCTTACACGGCCTCTGATTTCTCGAGAAATCAGAGGCCGTGTAAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks