EMAIL THIS PAGE TO A FRIEND

CSGALNACT2

chondroitin sulfate N-acetylgalactosaminyltransferase 2

90 Gene Product Result for
Synonyms: CHGN2 GALNACT-2 GALNACT2
UniProtKB ID: Q8N6G5, B3KWL7, Q6MZJ5, Q6MZP6, Q8TCH4, Q9P1I6
Gene ID:
Human(55454) Summary: This gene encodes a member of the chondroitin N-acetylgalactosaminyltransferase family. The encoded protein is involved in elongation during chondroitin sulfate synthesis. A related pseudogene has been identified on chromosome X. [provided by RefSeq, Dec 2012]
Mouse(78752) chondroitin sulfate N-acetylgalactosaminyltransferase 2
Rat(297554) chondroitin sulfate N-acetylgalactosaminyltransferase 2
domestic guinea pig(100735627) chondroitin sulfate N-acetylgalactosaminyltransferase 2
naked mole-rat(101719048) chondroitin sulfate N-acetylgalactosaminyltransferase 2
sheep(101118243) chondroitin sulfate N-acetylgalactosaminyltransferase 2
Zebrafish(337862) chondroitin sulfate N-acetylgalactosaminyltransferase 2
cow(509328) chondroitin sulfate N-acetylgalactosaminyltransferase 2
Horse(100050200) chondroitin sulfate N-acetylgalactosaminyltransferase 2
domestic cat(101100841) chondroitin sulfate N-acetylgalactosaminyltransferase 2
dog(486786) chondroitin sulfate N-acetylgalactosaminyltransferase 2
chicken(423632) chondroitin sulfate N-acetylgalactosaminyltransferase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018590 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018590 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018590 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030165 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030165 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030165 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018590 Rosetta Predictions human pricing
NM_001106616 Rosetta Predictions rat pricing
NM_030165 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018590 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212750 predicted 517
2 SASI_Hs01_00212751 predicted 1456
3 SASI_Hs01_00212753 predicted 556
4 SASI_Hs01_00212755 predicted 1706
5 SASI_Hs02_00352125 predicted 1199
6 SASI_Hs01_00212757 predicted 1115
7 SASI_Hs01_00212758 predicted 603
8 SASI_Hs01_00212759 predicted 1230
9 SASI_Hs02_00352126 predicted 1039
10 SASI_Hs02_00352127 predicted 1325
11 SASI_Hs01_00212752 predicted 1186
12 SASI_Hs01_00212754 predicted 1132
13 SASI_Hs01_00212756 predicted 656
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106616 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00220698 predicted 1772
2 SASI_Rn02_00220699 predicted 1713
3 SASI_Rn02_00220700 predicted 1507
4 SASI_Rn02_00220701 predicted 1248
5 SASI_Rn02_00220702 predicted 1243
6 SASI_Rn02_00220703 predicted 1175
7 SASI_Rn02_00220704 predicted 2054
8 SASI_Rn02_00220705 predicted 735
9 SASI_Rn02_00220706 predicted 1230
10 SASI_Rn02_00220707 predicted 1002
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030165 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00109346 predicted 1718
2 SASI_Mm01_00109347 predicted 1052
3 SASI_Mm01_00109348 predicted 2058
4 SASI_Mm01_00109349 predicted 1256
5 SASI_Mm01_00109350 predicted 623
6 SASI_Mm01_00109351 predicted 1248
7 SASI_Mm01_00109352 predicted 1755
8 SASI_Mm01_00109353 predicted 1005
9 SASI_Mm01_00109354 predicted 2032
10 SASI_Mm02_00336567 predicted 1040
11 SASI_Mm01_00109355 predicted 1903
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018590
VALIDATED
CSGALNACT2 MISSION shRNA Bacterial Glycerol Stock
chondroitin sulfate N-acetylgalactosaminyltransferase 2
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000319329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018590.3-498s21c1
Sequence:CCGGGAGTATTATCAAGCCCTCCTACTCGAGTAGGAGGGCTTGATAATACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319332    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018590.3-1979s21c1
Sequence:CCGGCGTTACTGTATGAACCACAAACTCGAGTTTGTGGTTCATACAGTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018590.3-1170s21c1
Sequence:CCGGGCTGAAAGAACTGAAGCATTTCTCGAGAAATGCTTCAGTTCTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018590.3-864s21c1
Sequence:CCGGCGAGATGAATTGGTGGAAGTTCTCGAGAACTTCCACCAATTCATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018590.3-442s1c1
Sequence:CCGGCCCAGACTGATGGAAATGCATCTCGAGATGCATTTCCATCAGTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018590.3-498s1c1
Sequence:CCGGGAGTATTATCAAGCCCTCCTACTCGAGTAGGAGGGCTTGATAATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154970    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018590.3-652s1c1
Sequence:CCGGGCATAGGCTATCAGAGCAACACTCGAGTGTTGCTCTGATAGCCTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018590.3-1170s1c1
Sequence:CCGGGCTGAAAGAACTGAAGCATTTCTCGAGAAATGCTTCAGTTCTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150897    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018590.3-1515s1c1
Sequence:CCGGGTGGTGTTCAGTCTTTACAATCTCGAGATTGTAAAGACTGAACACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151072    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018590.3-1916s1c1
Sequence:CCGGGCATCTTCATAAACAGGCATACTCGAGTATGCCTGTTTATGAAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151456    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018590.3-1979s1c1
Sequence:CCGGCGTTACTGTATGAACCACAAACTCGAGTTTGTGGTTCATACAGTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018590.3-864s1c1
Sequence:CCGGCGAGATGAATTGGTGGAAGTTCTCGAGAACTTCCACCAATTCATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018590
VALIDATED
CSGALNACT2 MISSION shRNA shRNA Plasmid DNA
chondroitin sulfate N-acetylgalactosaminyltransferase 2
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000319329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018590.3-498s21c1
Sequence:CCGGGAGTATTATCAAGCCCTCCTACTCGAGTAGGAGGGCTTGATAATACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319332    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018590.3-1979s21c1
Sequence:CCGGCGTTACTGTATGAACCACAAACTCGAGTTTGTGGTTCATACAGTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018590.3-1170s21c1
Sequence:CCGGGCTGAAAGAACTGAAGCATTTCTCGAGAAATGCTTCAGTTCTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018590.3-864s21c1
Sequence:CCGGCGAGATGAATTGGTGGAAGTTCTCGAGAACTTCCACCAATTCATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018590.3-442s1c1
Sequence:CCGGCCCAGACTGATGGAAATGCATCTCGAGATGCATTTCCATCAGTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018590.3-498s1c1
Sequence:CCGGGAGTATTATCAAGCCCTCCTACTCGAGTAGGAGGGCTTGATAATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154970    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018590.3-652s1c1
Sequence:CCGGGCATAGGCTATCAGAGCAACACTCGAGTGTTGCTCTGATAGCCTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018590.3-1170s1c1
Sequence:CCGGGCTGAAAGAACTGAAGCATTTCTCGAGAAATGCTTCAGTTCTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150897    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018590.3-1515s1c1
Sequence:CCGGGTGGTGTTCAGTCTTTACAATCTCGAGATTGTAAAGACTGAACACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151072    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018590.3-1916s1c1
Sequence:CCGGGCATCTTCATAAACAGGCATACTCGAGTATGCCTGTTTATGAAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151456    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018590.3-1979s1c1
Sequence:CCGGCGTTACTGTATGAACCACAAACTCGAGTTTGTGGTTCATACAGTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018590.3-864s1c1
Sequence:CCGGCGAGATGAATTGGTGGAAGTTCTCGAGAACTTCCACCAATTCATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018590
VALIDATED
CSGALNACT2 MISSION shRNA Lentiviral Transduction Particles
chondroitin sulfate N-acetylgalactosaminyltransferase 2
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000319329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018590.3-498s21c1
Sequence:CCGGGAGTATTATCAAGCCCTCCTACTCGAGTAGGAGGGCTTGATAATACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319332    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018590.3-1979s21c1
Sequence:CCGGCGTTACTGTATGAACCACAAACTCGAGTTTGTGGTTCATACAGTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018590.3-1170s21c1
Sequence:CCGGGCTGAAAGAACTGAAGCATTTCTCGAGAAATGCTTCAGTTCTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018590.3-864s21c1
Sequence:CCGGCGAGATGAATTGGTGGAAGTTCTCGAGAACTTCCACCAATTCATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018590.3-442s1c1
Sequence:CCGGCCCAGACTGATGGAAATGCATCTCGAGATGCATTTCCATCAGTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018590.3-498s1c1
Sequence:CCGGGAGTATTATCAAGCCCTCCTACTCGAGTAGGAGGGCTTGATAATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154970    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018590.3-652s1c1
Sequence:CCGGGCATAGGCTATCAGAGCAACACTCGAGTGTTGCTCTGATAGCCTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018590.3-1170s1c1
Sequence:CCGGGCTGAAAGAACTGAAGCATTTCTCGAGAAATGCTTCAGTTCTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150897    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018590.3-1515s1c1
Sequence:CCGGGTGGTGTTCAGTCTTTACAATCTCGAGATTGTAAAGACTGAACACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151072    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018590.3-1916s1c1
Sequence:CCGGGCATCTTCATAAACAGGCATACTCGAGTATGCCTGTTTATGAAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151456    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018590.3-1979s1c1
Sequence:CCGGCGTTACTGTATGAACCACAAACTCGAGTTTGTGGTTCATACAGTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018590.3-864s1c1
Sequence:CCGGCGAGATGAATTGGTGGAAGTTCTCGAGAACTTCCACCAATTCATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030165
VALIDATED
CSGALNACT2 MISSION shRNA Bacterial Glycerol Stock
chondroitin sulfate N-acetylgalactosaminyltransferase 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000295792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030165.3-1411s21c1
Sequence:CCGGTAATCGTGGACGAGGACTAAACTCGAGTTTAGTCCTCGTCCACGATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030165.3-489s21c1
Sequence:CCGGCCCAGACTGATGGAAATGCTTCTCGAGAAGCATTTCCATCAGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030165.3-1686s21c1
Sequence:CCGGCCTGTCAATATCAATCGGATTCTCGAGAATCCGATTGATATTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288551    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030165.3-2045s21c1
Sequence:CCGGGCACTGTTAATTCAGCCTTAACTCGAGTTAAGGCTGAATTAACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030165.3-440s21c1
Sequence:CCGGGCTTTGCTCTTCAGTTTAGTACTCGAGTACTAAACTGAAGAGCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030165.2-421s1c1
Sequence:CCGGGCTTTGCTCTTCAGTTTAGTACTCGAGTACTAAACTGAAGAGCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030165.2-470s1c1
Sequence:CCGGCCCAGACTGATGGAAATGCTTCTCGAGAAGCATTTCCATCAGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030165.2-1668s1c1
Sequence:CCGGCTGTCAATATCAATCGGATTTCTCGAGAAATCCGATTGATATTGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030165.2-1667s1c1
Sequence:CCGGCCTGTCAATATCAATCGGATTCTCGAGAATCCGATTGATATTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110460    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030165.2-2026s1c1
Sequence:CCGGGCACTGTTAATTCAGCCTTAACTCGAGTTAAGGCTGAATTAACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030165
VALIDATED
CSGALNACT2 MISSION shRNA shRNA Plasmid DNA
chondroitin sulfate N-acetylgalactosaminyltransferase 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000295792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030165.3-1411s21c1
Sequence:CCGGTAATCGTGGACGAGGACTAAACTCGAGTTTAGTCCTCGTCCACGATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030165.3-489s21c1
Sequence:CCGGCCCAGACTGATGGAAATGCTTCTCGAGAAGCATTTCCATCAGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030165.3-1686s21c1
Sequence:CCGGCCTGTCAATATCAATCGGATTCTCGAGAATCCGATTGATATTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288551    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030165.3-2045s21c1
Sequence:CCGGGCACTGTTAATTCAGCCTTAACTCGAGTTAAGGCTGAATTAACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030165.3-440s21c1
Sequence:CCGGGCTTTGCTCTTCAGTTTAGTACTCGAGTACTAAACTGAAGAGCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030165.2-421s1c1
Sequence:CCGGGCTTTGCTCTTCAGTTTAGTACTCGAGTACTAAACTGAAGAGCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030165.2-470s1c1
Sequence:CCGGCCCAGACTGATGGAAATGCTTCTCGAGAAGCATTTCCATCAGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030165.2-1668s1c1
Sequence:CCGGCTGTCAATATCAATCGGATTTCTCGAGAAATCCGATTGATATTGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030165.2-1667s1c1
Sequence:CCGGCCTGTCAATATCAATCGGATTCTCGAGAATCCGATTGATATTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110460    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030165.2-2026s1c1
Sequence:CCGGGCACTGTTAATTCAGCCTTAACTCGAGTTAAGGCTGAATTAACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030165
VALIDATED
CSGALNACT2 MISSION shRNA Lentiviral Transduction Particles
chondroitin sulfate N-acetylgalactosaminyltransferase 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000295792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030165.3-1411s21c1
Sequence:CCGGTAATCGTGGACGAGGACTAAACTCGAGTTTAGTCCTCGTCCACGATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030165.3-489s21c1
Sequence:CCGGCCCAGACTGATGGAAATGCTTCTCGAGAAGCATTTCCATCAGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030165.3-1686s21c1
Sequence:CCGGCCTGTCAATATCAATCGGATTCTCGAGAATCCGATTGATATTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288551    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030165.3-2045s21c1
Sequence:CCGGGCACTGTTAATTCAGCCTTAACTCGAGTTAAGGCTGAATTAACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030165.3-440s21c1
Sequence:CCGGGCTTTGCTCTTCAGTTTAGTACTCGAGTACTAAACTGAAGAGCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030165.2-421s1c1
Sequence:CCGGGCTTTGCTCTTCAGTTTAGTACTCGAGTACTAAACTGAAGAGCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030165.2-470s1c1
Sequence:CCGGCCCAGACTGATGGAAATGCTTCTCGAGAAGCATTTCCATCAGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030165.2-1668s1c1
Sequence:CCGGCTGTCAATATCAATCGGATTTCTCGAGAAATCCGATTGATATTGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030165.2-1667s1c1
Sequence:CCGGCCTGTCAATATCAATCGGATTCTCGAGAATCCGATTGATATTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110460    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030165.2-2026s1c1
Sequence:CCGGGCACTGTTAATTCAGCCTTAACTCGAGTTAAGGCTGAATTAACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks