EMAIL THIS PAGE TO A FRIEND

CSH1

chorionic somatomammotropin hormone 1 (placental lactogen)

92 Gene Product Result for
Synonyms: CS-1 CSA CSMT PL hCS-A
Species: Human CSH1(1442)
UniProtKB ID: P01243, Q0VDB1, Q14407
Gene ID:
Human(1442) Summary: The protein encoded by this gene is a member of the somatotropin/prolactin family of hormones and plays an important role in growth control. The gene is located at the growth hormone locus on chromosome 17 along with four other related genes in the same transcriptional orientation; an arrangement which is thought to have evolved by a series of gene duplications. Although the five genes share a remarkably high degree of sequence identity, they are expressed selectively in different tissues. Alternative splicing generates additional isoforms of each of the five growth hormones, leading to further diversity and potential for specialization. This particular family member is expressed mainly in the placenta and utilizes multiple transcription initiation sites. Expression of the identical mature proteins for chorionic somatomammotropin hormones 1 and 2 is upregulated during development, although the ratio of 1 to 2 increases by term. Mutations in this gene result in placental lactogen deficiency and Silver-Russell syndrome. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001317 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001317 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001317 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU128341 MISSION® esiRNA esiRNA human CSH1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001317 Rosetta Predictions human pricing
NM_022640 Rosetta Predictions human pricing
NM_022641 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001317 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00331609 predicted 758
2 SASI_Hs02_00331610 predicted 393
3 SASI_Hs02_00331611 predicted 469
4 SASI_Hs01_00010471 predicted 307
5 SASI_Hs01_00010472 predicted 284
6 SASI_Hs01_00010473 predicted 354
7 SASI_Hs01_00010474 predicted 278
8 SASI_Hs01_00010475 predicted 300
9 SASI_Hs01_00010476 predicted 256
10 SASI_Hs01_00010477 predicted 205
11 SASI_Hs01_00010478 predicted 342
12 SASI_Hs01_00010479 predicted 254
13 SASI_Hs01_00010480 predicted 308
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022640 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00355897 predicted 1009
2 SASI_Hs02_00355898 predicted 686
3 SASI_Hs02_00355899 predicted 388
4 SASI_Hs01_00162376 predicted 307
5 SASI_Hs01_00162377 predicted 279
6 SASI_Hs01_00162378 predicted 354
7 SASI_Hs01_00162379 predicted 285
8 SASI_Hs01_00162380 predicted 298
9 SASI_Hs01_00162381 predicted 253
10 SASI_Hs01_00162382 predicted 199
11 SASI_Hs01_00162383 predicted 348
12 SASI_Hs01_00162384 predicted 255
13 SASI_Hs01_00162385 predicted 307
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022641 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00026261 predicted 277
2 SASI_Hs02_00355900 predicted 271
3 SASI_Hs02_00355901 predicted 298
4 SASI_Hs02_00355902 predicted 471
5 SASI_Hs01_00026257 predicted 349
6 SASI_Hs01_00026258 predicted 370
7 SASI_Hs01_00026259 predicted 355
8 SASI_Hs01_00026260 predicted 246
9 SASI_Hs01_00026262 predicted 207
10 SASI_Hs01_00026263 predicted 249
11 SASI_Hs01_00026264 predicted 355
12 SASI_Hs01_00026265 predicted 343
13 SASI_Hs01_00026266 predicted 358
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001317
CSH1 MISSION shRNA Bacterial Glycerol Stock
chorionic somatomammotropin hormone 1 (placental lactogen)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001317.3-517s1c1
Sequence:CCGGGCGATGACTATCACCTCCTAACTCGAGTTAGGAGGTGATAGTCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001317.3-280s1c1
Sequence:CCGGAGGAGTTTGAAGAAACCTATACTCGAGTATAGGTTTCTTCAAACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001317.3-390s1c1
Sequence:CCGGGAAACGCAACAGAAATCCAATCTCGAGATTGGATTTCTGTTGCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001317.3-620s1c1
Sequence:CCGGCTACAGCAAGTTTGACACAAACTCGAGTTTGTGTCAAACTTGCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001317.3-279s1c1
Sequence:CCGGCAGGAGTTTGAAGAAACCTATCTCGAGATAGGTTTCTTCAAACTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001317.3-702s21c1
Sequence:CCGGATGGACAAGGTCGAGACATTCCTCGAGGAATGTCTCGACCTTGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001317.3-348s21c1
Sequence:CCGGTTCTGCTTCTCAGACTCTATTCTCGAGAATAGAGTCTGAGAAGCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001317.3-484s21c1
Sequence:CCGGTCGCCAACAACCTGGTGTATGCTCGAGCATACACCAGGTTGTTGGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001317
CSH1 MISSION shRNA shRNA Plasmid DNA
chorionic somatomammotropin hormone 1 (placental lactogen)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001317.3-517s1c1
Sequence:CCGGGCGATGACTATCACCTCCTAACTCGAGTTAGGAGGTGATAGTCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001317.3-280s1c1
Sequence:CCGGAGGAGTTTGAAGAAACCTATACTCGAGTATAGGTTTCTTCAAACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001317.3-390s1c1
Sequence:CCGGGAAACGCAACAGAAATCCAATCTCGAGATTGGATTTCTGTTGCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001317.3-620s1c1
Sequence:CCGGCTACAGCAAGTTTGACACAAACTCGAGTTTGTGTCAAACTTGCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001317.3-279s1c1
Sequence:CCGGCAGGAGTTTGAAGAAACCTATCTCGAGATAGGTTTCTTCAAACTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001317.3-702s21c1
Sequence:CCGGATGGACAAGGTCGAGACATTCCTCGAGGAATGTCTCGACCTTGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001317.3-348s21c1
Sequence:CCGGTTCTGCTTCTCAGACTCTATTCTCGAGAATAGAGTCTGAGAAGCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001317.3-484s21c1
Sequence:CCGGTCGCCAACAACCTGGTGTATGCTCGAGCATACACCAGGTTGTTGGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001317
CSH1 MISSION shRNA Lentiviral Transduction Particles
chorionic somatomammotropin hormone 1 (placental lactogen)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001317.3-517s1c1
Sequence:CCGGGCGATGACTATCACCTCCTAACTCGAGTTAGGAGGTGATAGTCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001317.3-280s1c1
Sequence:CCGGAGGAGTTTGAAGAAACCTATACTCGAGTATAGGTTTCTTCAAACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001317.3-390s1c1
Sequence:CCGGGAAACGCAACAGAAATCCAATCTCGAGATTGGATTTCTGTTGCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001317.3-620s1c1
Sequence:CCGGCTACAGCAAGTTTGACACAAACTCGAGTTTGTGTCAAACTTGCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001317.3-279s1c1
Sequence:CCGGCAGGAGTTTGAAGAAACCTATCTCGAGATAGGTTTCTTCAAACTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001317.3-702s21c1
Sequence:CCGGATGGACAAGGTCGAGACATTCCTCGAGGAATGTCTCGACCTTGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001317.3-348s21c1
Sequence:CCGGTTCTGCTTCTCAGACTCTATTCTCGAGAATAGAGTCTGAGAAGCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001317.3-484s21c1
Sequence:CCGGTCGCCAACAACCTGGTGTATGCTCGAGCATACACCAGGTTGTTGGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks