EMAIL THIS PAGE TO A FRIEND

CSH2

chorionic somatomammotropin hormone 2

69 Gene Product Result for
Synonyms: CS-2 CSB hCS-B
Gene ID:
Human(1443) Summary: The protein encoded by this gene is a member of the somatotropin/prolactin family of hormones and plays an important role in growth control. The gene is located at the growth hormone locus on chromosome 17 along with four other related genes in the same transcriptional orientation; an arrangement which is thought to have evolved by a series of gene duplications. Although the five genes share a remarkably high degree of sequence identity, they are expressed selectively in different tissues. Alternative splicing generates additional isoforms of each of the five growth hormones. This particular family member is expressed mainly in the placenta and utilizes multiple transcription initiation sites. Expression of the identical mature proteins for chorionic somatomammotropin hormones 1 and 2 is upregulated during development, while the ratio of 1 to 2 increases by term. Structural and expression differences provide avenues for developmental regulation and tissue specificity. [provided by RefSeq, Jul 2008]
cow(281097) chorionic somatomammotropin hormone 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1400056 Anti-CSH2 antibody produced in mouse IgG fraction of antiserum, buffered aqueous solution human
ELISA, western blot pricing
SAB1400057 Anti-CSH2 antibody produced in mouse IgG fraction of antiserum, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB2105837 Anti-CSH2 antibody produced in rabbit affinity isolated antibody guinea pig, horse, sheep, rabbit, human, goat
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020991 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020991 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020991 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020991 Rosetta Predictions human pricing
NM_022644 Rosetta Predictions human pricing
NM_022645 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020991 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00354453 predicted 739
2 SASI_Hs02_00354454 predicted 390
3 SASI_Hs01_00161275 predicted 311
4 SASI_Hs01_00161276 predicted 277
5 SASI_Hs01_00161277 predicted 354
6 SASI_Hs01_00161278 predicted 279
7 SASI_Hs01_00161279 predicted 297
8 SASI_Hs01_00161280 predicted 253
9 SASI_Hs01_00161281 predicted 206
10 SASI_Hs01_00161282 predicted 343
11 SASI_Hs01_00161283 predicted 248
12 SASI_Hs01_00161284 predicted 302
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022644 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00355903 predicted 986
2 SASI_Hs02_00355904 predicted 686
3 SASI_Hs02_00355905 predicted 387
4 SASI_Hs01_00139603 predicted 306
5 SASI_Hs01_00139604 predicted 279
6 SASI_Hs01_00139605 predicted 350
7 SASI_Hs01_00139606 predicted 277
8 SASI_Hs01_00139607 predicted 302
9 SASI_Hs01_00139608 predicted 253
10 SASI_Hs01_00139609 predicted 197
11 SASI_Hs01_00139610 predicted 342
12 SASI_Hs01_00139611 predicted 253
13 SASI_Hs01_00139612 predicted 301
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022645 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00202122 predicted 276
2 SASI_Hs02_00355906 predicted 270
3 SASI_Hs02_00355907 predicted 297
4 SASI_Hs02_00355908 predicted 455
5 SASI_Hs01_00202117 predicted 356
6 SASI_Hs01_00202118 predicted 369
7 SASI_Hs01_00202119 predicted 351
8 SASI_Hs01_00202120 predicted 245
9 SASI_Hs01_00202121 predicted 344
10 SASI_Hs01_00202123 predicted 197
11 SASI_Hs01_00202124 predicted 245
12 SASI_Hs01_00202125 predicted 363
13 SASI_Hs01_00202126 predicted 202
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020991
CSH2 MISSION shRNA Bacterial Glycerol Stock
chorionic somatomammotropin hormone 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166199    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020991.3-382s1c1
Sequence:CCGGCATGGAGGAAACGCAACAGAACTCGAGTTCTGTTGCGTTTCCTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166095    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020991.3-613s1c1
Sequence:CCGGGCAGACCTACAGCAAGTTTGACTCGAGTCAAACTTGCTGTAGGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166034    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020991.3-700s1c1
Sequence:CCGGCATGGACAAGGTCGAGACATTCTCGAGAATGTCTCGACCTTGTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020991.3-278s1c1
Sequence:CCGGCAGGAGTTTGAAGAAACCTATCTCGAGATAGGTTTCTTCAAACTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158937    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020991.3-389s1c1
Sequence:CCGGGAAACGCAACAGAAATCCAATCTCGAGATTGGATTTCTGTTGCGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160300    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020991.3-311s1c1
Sequence:CCGGCAGAAGTATTCATTCCTGCATCTCGAGATGCAGGAATGAATACTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162110    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020991.3-310s1c1
Sequence:CCGGCCAGAAGTATTCATTCCTGCACTCGAGTGCAGGAATGAATACTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162330    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020991.3-295s1c1
Sequence:CCGGCTATATCCCAAAGGACCAGAACTCGAGTTCTGGTCCTTTGGGATATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164750    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020991.3-472s1c1
Sequence:CCGGCAGGAGTATGTTCGCCAACAACTCGAGTTGTTGGCGAACATACTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020991
CSH2 MISSION shRNA shRNA Plasmid DNA
chorionic somatomammotropin hormone 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166199    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020991.3-382s1c1
Sequence:CCGGCATGGAGGAAACGCAACAGAACTCGAGTTCTGTTGCGTTTCCTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166095    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020991.3-613s1c1
Sequence:CCGGGCAGACCTACAGCAAGTTTGACTCGAGTCAAACTTGCTGTAGGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166034    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020991.3-700s1c1
Sequence:CCGGCATGGACAAGGTCGAGACATTCTCGAGAATGTCTCGACCTTGTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020991.3-278s1c1
Sequence:CCGGCAGGAGTTTGAAGAAACCTATCTCGAGATAGGTTTCTTCAAACTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158937    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020991.3-389s1c1
Sequence:CCGGGAAACGCAACAGAAATCCAATCTCGAGATTGGATTTCTGTTGCGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160300    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020991.3-311s1c1
Sequence:CCGGCAGAAGTATTCATTCCTGCATCTCGAGATGCAGGAATGAATACTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162110    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020991.3-310s1c1
Sequence:CCGGCCAGAAGTATTCATTCCTGCACTCGAGTGCAGGAATGAATACTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162330    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020991.3-295s1c1
Sequence:CCGGCTATATCCCAAAGGACCAGAACTCGAGTTCTGGTCCTTTGGGATATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164750    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020991.3-472s1c1
Sequence:CCGGCAGGAGTATGTTCGCCAACAACTCGAGTTGTTGGCGAACATACTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020991
CSH2 MISSION shRNA Lentiviral Transduction Particles
chorionic somatomammotropin hormone 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166199    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020991.3-382s1c1
Sequence:CCGGCATGGAGGAAACGCAACAGAACTCGAGTTCTGTTGCGTTTCCTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166095    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020991.3-613s1c1
Sequence:CCGGGCAGACCTACAGCAAGTTTGACTCGAGTCAAACTTGCTGTAGGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166034    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020991.3-700s1c1
Sequence:CCGGCATGGACAAGGTCGAGACATTCTCGAGAATGTCTCGACCTTGTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020991.3-278s1c1
Sequence:CCGGCAGGAGTTTGAAGAAACCTATCTCGAGATAGGTTTCTTCAAACTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158937    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020991.3-389s1c1
Sequence:CCGGGAAACGCAACAGAAATCCAATCTCGAGATTGGATTTCTGTTGCGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160300    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020991.3-311s1c1
Sequence:CCGGCAGAAGTATTCATTCCTGCATCTCGAGATGCAGGAATGAATACTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162110    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020991.3-310s1c1
Sequence:CCGGCCAGAAGTATTCATTCCTGCACTCGAGTGCAGGAATGAATACTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162330    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020991.3-295s1c1
Sequence:CCGGCTATATCCCAAAGGACCAGAACTCGAGTTCTGGTCCTTTGGGATATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164750    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020991.3-472s1c1
Sequence:CCGGCAGGAGTATGTTCGCCAACAACTCGAGTTGTTGGCGAACATACTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks