EMAIL THIS PAGE TO A FRIEND

CSHL1

chorionic somatomammotropin hormone-like 1

78 Gene Product Result for
Synonyms: CS-5 CSHP1 CSL hCS-L
Species: Human CSHL1(1444)
UniProtKB ID: Q14406, D3DU26, D3DU27, Q0VDB2
Gene ID:
Human(1444) Summary: The protein encoded by this gene is a member of the somatotropin/prolactin family of hormones which play an important role in growth control. The gene, along with four other related genes, is located at the growth hormone locus on chromosome 17 where they are interspersed in the same transcriptional orientation; an arrangement which is thought to have evolved by a series of gene duplications. Although the five genes share a remarkably high degree of sequence identity, they are expressed selectively in different tissues. This particular family member is expressed in placental villi, although it was originally thought to be a pseudogene. In fact, alternative splicing suggests that the majority of the transcripts would be unable to express a secreted protein. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1303653 ANTI-CSHL1 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB2100490 Anti-CSHL1 antibody produced in rabbit affinity isolated antibody canine, mouse, goat, horse, sheep, guinea pig, rabbit, rat, human, rabbit
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001318 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001318 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001318 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001318 Rosetta Predictions human pricing
NM_022579 Rosetta Predictions human pricing
NM_022580 Rosetta Predictions human pricing
NM_022581 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001318 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00331612 predicted 364
2 SASI_Hs02_00331613 predicted 250
3 SASI_Hs02_00331614 predicted 254
4 SASI_Hs02_00331615 predicted 175
5 SASI_Hs02_00331616 predicted 258
6 SASI_Hs01_00242388 predicted 438
7 SASI_Hs01_00242389 predicted 423
8 SASI_Hs01_00242390 predicted 436
9 SASI_Hs01_00242391 predicted 422
10 SASI_Hs01_00242392 predicted 433
11 SASI_Hs01_00242393 predicted 438
12 SASI_Hs01_00242394 predicted 425
13 SASI_Hs01_00242395 predicted 406
14 SASI_Hs01_00242396 predicted 431
15 SASI_Hs01_00242397 predicted 427
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022579 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00355882 predicted 537
2 SASI_Hs02_00355883 predicted 213
3 SASI_Hs02_00355884 predicted 418
4 SASI_Hs02_00355885 predicted 424
5 SASI_Hs02_00355886 predicted 430
6 SASI_Hs01_00131107 predicted 615
7 SASI_Hs01_00131108 predicted 598
8 SASI_Hs01_00131109 predicted 619
9 SASI_Hs01_00131110 predicted 601
10 SASI_Hs01_00131111 predicted 611
11 SASI_Hs01_00131112 predicted 605
12 SASI_Hs01_00131113 predicted 607
13 SASI_Hs01_00131114 predicted 590
14 SASI_Hs01_00131115 predicted 604
15 SASI_Hs01_00131116 predicted 604
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022580 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00355887 predicted 295
2 SASI_Hs02_00355888 predicted 168
3 SASI_Hs02_00355889 predicted 177
4 SASI_Hs02_00355890 predicted 100
5 SASI_Hs02_00355891 predicted 177
6 SASI_Hs01_00149504 predicted 363
7 SASI_Hs01_00149505 predicted 351
8 SASI_Hs01_00149506 predicted 364
9 SASI_Hs01_00149507 predicted 348
10 SASI_Hs01_00149508 predicted 360
11 SASI_Hs01_00149509 predicted 359
12 SASI_Hs01_00149510 predicted 361
13 SASI_Hs01_00149511 predicted 336
14 SASI_Hs01_00149512 predicted 354
15 SASI_Hs01_00149513 predicted 356
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022581 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00355892 predicted 468
2 SASI_Hs02_00355893 predicted 215
3 SASI_Hs02_00355894 predicted 356
4 SASI_Hs02_00355895 predicted 356
5 SASI_Hs02_00355896 predicted 364
6 SASI_Hs01_00116340 predicted 539
7 SASI_Hs01_00116341 predicted 526
8 SASI_Hs01_00116342 predicted 544
9 SASI_Hs01_00116343 predicted 529
10 SASI_Hs01_00116344 predicted 537
11 SASI_Hs01_00116345 predicted 544
12 SASI_Hs01_00116346 predicted 532
13 SASI_Hs01_00116347 predicted 515
14 SASI_Hs01_00116348 predicted 541
15 SASI_Hs01_00116349 predicted 541
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001318
CSHL1 MISSION shRNA Bacterial Glycerol Stock
chorionic somatomammotropin hormone-like 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001318.2-258s1c1
Sequence:CCGGCAGGAGTACCTTCACCAACAACTCGAGTTGTTGGTGAAGGTACTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157795    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001318.2-396s1c1
Sequence:CCGGCAAGCAGACCTACAGCAAGTTCTCGAGAACTTGCTGTAGGTCTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001318.2-302s1c1
Sequence:CCGGGCGATGACTATCACCTCCTAACTCGAGTTAGGAGGTGATAGTCATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001318.2-418s1c1
Sequence:CCGGGACACAAACTCGCACAACCATCTCGAGATGGTTGTGCGAGTTTGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001318.2-267s1c1
Sequence:CCGGCTTCACCAACAACCTGGTGTACTCGAGTACACCAGGTTGTTGGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001318.2-414s1c1
Sequence:CCGGGTTTGACACAAACTCGCACAACTCGAGTTGTGCGAGTTTGTGTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155751    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001318.2-303s1c1
Sequence:CCGGCGATGACTATCACCTCCTAAACTCGAGTTTAGGAGGTGATAGTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001318.2-485s21c1
Sequence:CCGGACATGGACAAGGTCGAGACATCTCGAGATGTCTCGACCTTGTCCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001318.2-440s21c1
Sequence:CCGGACGCACTGCTCAAGAACTACGCTCGAGCGTAGTTCTTGAGCAGTGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001318
CSHL1 MISSION shRNA shRNA Plasmid DNA
chorionic somatomammotropin hormone-like 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001318.2-258s1c1
Sequence:CCGGCAGGAGTACCTTCACCAACAACTCGAGTTGTTGGTGAAGGTACTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157795    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001318.2-396s1c1
Sequence:CCGGCAAGCAGACCTACAGCAAGTTCTCGAGAACTTGCTGTAGGTCTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001318.2-302s1c1
Sequence:CCGGGCGATGACTATCACCTCCTAACTCGAGTTAGGAGGTGATAGTCATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001318.2-418s1c1
Sequence:CCGGGACACAAACTCGCACAACCATCTCGAGATGGTTGTGCGAGTTTGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001318.2-267s1c1
Sequence:CCGGCTTCACCAACAACCTGGTGTACTCGAGTACACCAGGTTGTTGGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001318.2-414s1c1
Sequence:CCGGGTTTGACACAAACTCGCACAACTCGAGTTGTGCGAGTTTGTGTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155751    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001318.2-303s1c1
Sequence:CCGGCGATGACTATCACCTCCTAAACTCGAGTTTAGGAGGTGATAGTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001318.2-485s21c1
Sequence:CCGGACATGGACAAGGTCGAGACATCTCGAGATGTCTCGACCTTGTCCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001318.2-440s21c1
Sequence:CCGGACGCACTGCTCAAGAACTACGCTCGAGCGTAGTTCTTGAGCAGTGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001318
CSHL1 MISSION shRNA Lentiviral Transduction Particles
chorionic somatomammotropin hormone-like 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001318.2-258s1c1
Sequence:CCGGCAGGAGTACCTTCACCAACAACTCGAGTTGTTGGTGAAGGTACTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157795    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001318.2-396s1c1
Sequence:CCGGCAAGCAGACCTACAGCAAGTTCTCGAGAACTTGCTGTAGGTCTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001318.2-302s1c1
Sequence:CCGGGCGATGACTATCACCTCCTAACTCGAGTTAGGAGGTGATAGTCATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001318.2-418s1c1
Sequence:CCGGGACACAAACTCGCACAACCATCTCGAGATGGTTGTGCGAGTTTGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001318.2-267s1c1
Sequence:CCGGCTTCACCAACAACCTGGTGTACTCGAGTACACCAGGTTGTTGGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001318.2-414s1c1
Sequence:CCGGGTTTGACACAAACTCGCACAACTCGAGTTGTGCGAGTTTGTGTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155751    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001318.2-303s1c1
Sequence:CCGGCGATGACTATCACCTCCTAAACTCGAGTTTAGGAGGTGATAGTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001318.2-485s21c1
Sequence:CCGGACATGGACAAGGTCGAGACATCTCGAGATGTCTCGACCTTGTCCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001318.2-440s21c1
Sequence:CCGGACGCACTGCTCAAGAACTACGCTCGAGCGTAGTTCTTGAGCAGTGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks