EMAIL THIS PAGE TO A FRIEND

CSK

c-src tyrosine kinase

141 Gene Product Result for
UniProtKB ID: P41240, Q2M3N2, Q6FGZ6
Gene ID:
Mouse(12988) c-src tyrosine kinase
Rat(315707) c-src tyrosine kinase
sheep(101108956) c-src tyrosine kinase
naked mole-rat(101710457) c-src tyrosine kinase
domestic guinea pig(100715103) c-src tyrosine kinase
Zebrafish(556454) c-src tyrosine kinase
Thale Cress(843110) chloroplast sensor kinase
fruit fly(41398) C-terminal Src kinase
cow(509246) c-src tyrosine kinase
Horse(100051462) c-src tyrosine kinase
domestic cat(101083340) c-src tyrosine kinase
dog(487649) c-src tyrosine kinase
chicken(396396) c-src tyrosine kinase
fruit fly(49602) costakink
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2500277 Anti-CSK antibody produced in goat affinity isolated antibody, buffered aqueous solution rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
C7863 Anti-Csk antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, rat
immunohistochemistry, microarray, western blot pricing
HPA026488 Anti-CSK antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, rat
immunohistochemistry, western blot pricing
HPA028425 Anti-CSK antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, rat, mouse
immunofluorescence, immunohistochemistry, western blot pricing
SAB4500506 Anti-CSK, C-Terminal antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB4500507 Anti-CSK, N-Terminal antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunofluorescence, western blot pricing
SAB1304742 ANTI-MOUSE CSK (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
western blot pricing
SAB4503861 Anti-phospho-Csk (pSer364) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
WH0001445M1 Monoclonal Anti-CSK antibody produced in mouse clone 3A3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB5300317 Monoclonal Anti-CSK antibody produced in mouse clone 5F3, ascites fluid mouse, human, monkey, rat
ELISA, flow cytometry, immunofluorescence, western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
E2250 Ellagic acid ≥95% (HPLC), powder, from tree bark human, rat pricing

ELISA

Product # Description Species Add to Cart
 
RAB0939 Phosphotyrosine CSK / Tyrosine-protein Kinase CSK ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007783 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007783 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007783 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004383 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004383 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004383 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127190 Rosetta Predictions human pricing
NM_004383 siRNAs that have been validated in the lab human pricing
NM_001030039 Rosetta Predictions rat pricing
NM_007783 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127190 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328637 predicted 824
2 SASI_Hs02_00328638 predicted 739
3 SASI_Hs02_00328639 predicted 1294
4 SASI_Hs02_00328640 predicted 1168
5 SASI_Hs02_00328641 predicted 1324
6 SASI_Hs02_00328642 predicted 667
7 SASI_Hs02_00328643 predicted 315
8 SASI_Hs02_00328644 predicted 597
9 SASI_Hs02_00328645 predicted 1262
10 SASI_Hs02_00328646 predicted 817
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004383 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00097529 validated 1268
1 SASI_Hs01_00097528 validated 1348
1 SASI_Hs01_00097530 validated 1816
2 SASI_Hs01_00097531 predicted 1684
3 SASI_Hs01_00097532 predicted 1843
4 SASI_Hs02_00337480 predicted 1184
5 SASI_Hs01_00097533 predicted 830
6 SASI_Hs01_00097535 predicted 1111
7 SASI_Hs01_00097536 predicted 1780
8 SASI_Hs01_00097537 predicted 1336
9 SASI_Hs01_00097534 predicted 907
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001030039 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00042419 predicted 455
2 SASI_Rn01_00042420 predicted 1106
3 SASI_Rn01_00042421 predicted 1153
4 SASI_Rn01_00042423 predicted 432
5 SASI_Rn02_00203550 predicted 695
6 SASI_Rn01_00042425 predicted 381
7 SASI_Rn02_00203551 predicted 991
8 SASI_Rn01_00042426 predicted 545
9 SASI_Rn01_00042427 predicted 421
10 SASI_Rn02_00203552 predicted 349
11 SASI_Rn01_00042422 predicted 354
12 SASI_Rn01_00042424 predicted 1080
13 SASI_Rn01_00042428 predicted 1023
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007783 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00088086 predicted 828
2 SASI_Mm02_00312451 predicted 1359
3 SASI_Mm01_00088087 predicted 595
4 SASI_Mm01_00088088 predicted 632
5 SASI_Mm01_00088089 predicted 1097
6 SASI_Mm01_00088090 predicted 626
7 SASI_Mm01_00088091 predicted 1553
8 SASI_Mm01_00088093 predicted 1260
9 SASI_Mm01_00088094 predicted 746
10 SASI_Mm01_00088095 predicted 651
11 SASI_Mm01_00088092 predicted 381
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007783
VALIDATED
CSK MISSION shRNA Bacterial Glycerol Stock
c-src tyrosine kinase
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000368701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007783.2-1282s21c1
Sequence:CCGGCAGGCAAGCTGCCAGTCAAATCTCGAGATTTGACTGGCAGCTTGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007783.2-1317s21c1
Sequence:CCGGGCCTTGAGAGAGAAGAAATTTCTCGAGAAATTTCTTCTCTCTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361164    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007783.2-2004s21c1
Sequence:CCGGCAAGAAGTACGAATCTTATTTCTCGAGAAATAAGATTCGTACTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007783.2-1156s21c1
Sequence:CCGGAGTACCTGGAGGGTAACAATTCTCGAGAATTGTTACCCTCCAGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007783.2-1398s21c1
Sequence:CCGGCGAGTGCCTTACCCAAGAATTCTCGAGAATTCTTGGGTAAGGCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321852    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007783.2-1981s21c1
Sequence:CCGGGTACCCAGCAAATGGGCATTTCTCGAGAAATGCCCATTTGCTGGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007783.2-278s1c1
Sequence:CCGGCGGTACAGAATGTATTGCCAACTCGAGTTGGCAATACATTCTGTACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007783.2-906s1c1
Sequence:CCGGGCAGTCAAGTGCATCAAGAATCTCGAGATTCTTGATGCACTTGACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007783.2-1398s1c1
Sequence:CCGGCGAGTGCCTTACCCAAGAATTCTCGAGAATTCTTGGGTAAGGCACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007783.2-1317s1c1
Sequence:CCGGGCCTTGAGAGAGAAGAAATTTCTCGAGAAATTTCTTCTCTCTCAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007783.2-746s1c1
Sequence:CCGGCCTCATCAAACCAAAGGTCATCTCGAGATGACCTTTGGTTTGATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007783
VALIDATED
CSK MISSION shRNA shRNA Plasmid DNA
c-src tyrosine kinase
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000368701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007783.2-1282s21c1
Sequence:CCGGCAGGCAAGCTGCCAGTCAAATCTCGAGATTTGACTGGCAGCTTGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007783.2-1317s21c1
Sequence:CCGGGCCTTGAGAGAGAAGAAATTTCTCGAGAAATTTCTTCTCTCTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361164    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007783.2-2004s21c1
Sequence:CCGGCAAGAAGTACGAATCTTATTTCTCGAGAAATAAGATTCGTACTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007783.2-1156s21c1
Sequence:CCGGAGTACCTGGAGGGTAACAATTCTCGAGAATTGTTACCCTCCAGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007783.2-1398s21c1
Sequence:CCGGCGAGTGCCTTACCCAAGAATTCTCGAGAATTCTTGGGTAAGGCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321852    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007783.2-1981s21c1
Sequence:CCGGGTACCCAGCAAATGGGCATTTCTCGAGAAATGCCCATTTGCTGGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007783.2-278s1c1
Sequence:CCGGCGGTACAGAATGTATTGCCAACTCGAGTTGGCAATACATTCTGTACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007783.2-906s1c1
Sequence:CCGGGCAGTCAAGTGCATCAAGAATCTCGAGATTCTTGATGCACTTGACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007783.2-1398s1c1
Sequence:CCGGCGAGTGCCTTACCCAAGAATTCTCGAGAATTCTTGGGTAAGGCACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007783.2-1317s1c1
Sequence:CCGGGCCTTGAGAGAGAAGAAATTTCTCGAGAAATTTCTTCTCTCTCAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007783.2-746s1c1
Sequence:CCGGCCTCATCAAACCAAAGGTCATCTCGAGATGACCTTTGGTTTGATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007783
VALIDATED
CSK MISSION shRNA Lentiviral Transduction Particles
c-src tyrosine kinase
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000368701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007783.2-1282s21c1
Sequence:CCGGCAGGCAAGCTGCCAGTCAAATCTCGAGATTTGACTGGCAGCTTGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007783.2-1317s21c1
Sequence:CCGGGCCTTGAGAGAGAAGAAATTTCTCGAGAAATTTCTTCTCTCTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361164    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007783.2-2004s21c1
Sequence:CCGGCAAGAAGTACGAATCTTATTTCTCGAGAAATAAGATTCGTACTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007783.2-1156s21c1
Sequence:CCGGAGTACCTGGAGGGTAACAATTCTCGAGAATTGTTACCCTCCAGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007783.2-1398s21c1
Sequence:CCGGCGAGTGCCTTACCCAAGAATTCTCGAGAATTCTTGGGTAAGGCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321852    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007783.2-1981s21c1
Sequence:CCGGGTACCCAGCAAATGGGCATTTCTCGAGAAATGCCCATTTGCTGGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007783.2-278s1c1
Sequence:CCGGCGGTACAGAATGTATTGCCAACTCGAGTTGGCAATACATTCTGTACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007783.2-906s1c1
Sequence:CCGGGCAGTCAAGTGCATCAAGAATCTCGAGATTCTTGATGCACTTGACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007783.2-1398s1c1
Sequence:CCGGCGAGTGCCTTACCCAAGAATTCTCGAGAATTCTTGGGTAAGGCACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007783.2-1317s1c1
Sequence:CCGGGCCTTGAGAGAGAAGAAATTTCTCGAGAAATTTCTTCTCTCTCAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007783.2-746s1c1
Sequence:CCGGCCTCATCAAACCAAAGGTCATCTCGAGATGACCTTTGGTTTGATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004383
VALIDATED
CSK MISSION shRNA Bacterial Glycerol Stock
c-src tyrosine kinase
Human
22 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000342288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004383.2-1125s21c1
Sequence:CCGGCGAGGAGGTGTACTTTGAGAACTCGAGTTCTCAAAGTACACCTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004383.2-1166s21c1
Sequence:CCGGACTACACCTCAGACGCAGATGCTCGAGCATCTGCGTCTGAGGTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004383.2-1193s21c1
Sequence:CCGGGTACGCGCCTCATTAAACCAACTCGAGTTGGTTTAATGAGGCGCGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004383.2-1938s21c1
Sequence:CCGGGCCCGCAGTCTATGAAGTCATCTCGAGATGACTTCATAGACTGCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004383.2-1900s21c1
Sequence:CCGGGAGAAGGGCTACAAGATGGATCTCGAGATCCATCTTGTAGCCCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004383.1-592s1c1
Sequence:CCGGCCCAGCCAACTACGTCCAGAACTCGAGTTCTGGACGTAGTTGGCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004383.1-1538s1c1
Sequence:CCGGCTCTGGGAAATCTACTCCTTTCTCGAGAAAGGAGTAGATTTCCCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199031    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004383.1-1916s1c1
Sequence:CCGGCCGTCTCTCTTGGACCCACCTCTCGAGAGGTGGGTCCAAGAGAGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199755    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004383.1-1121s1c1
Sequence:CCGGGCCTCAGTCATGACGCAACTGCTCGAGCAGTTGCGTCATGACTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199611    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004383.1-1034s1c1
Sequence:CCGGGACGTGATGCTGGGCGATTACCTCGAGGTAATCGCCCAGCATCACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004383.1-1503s1c1
Sequence:CCGGCCACTAAGTCTGACGTGTGGACTCGAGTCCACACGTCAGACTTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004383.1-1648s1c1
Sequence:CCGGGCCCGCAGTCTATGAAGTCATCTCGAGATGACTTCATAGACTGCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004383.x-1057s1c1
Sequence:CCGGAGGGAACAAAGTCGCCGTCAACTCGAGTTGACGGCGACTTTGTTCCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004383.x-876s1c1
Sequence:CCGGACTACACCTCAGACGCAGATGCTCGAGCATCTGCGTCTGAGGTGTAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004383.x-903s1c1
Sequence:CCGGGTACGCGCCTCATTAAACCAACTCGAGTTGGTTTAATGAGGCGCGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004383.x-1079s1c1
Sequence:CCGGTGCATTAAGAACGACGCCACTCTCGAGAGTGGCGTCGTTCTTAATGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004383.x-1610s1c1
Sequence:CCGGGAGAAGGGCTACAAGATGGATCTCGAGATCCATCTTGTAGCCCTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004383.x-1280s1c1
Sequence:CCGGTGTCTCCTCAAGTTCTCGCTACTCGAGTAGCGAGAACTTGAGGAGACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004383.x-835s1c1
Sequence:CCGGCGAGGAGGTGTACTTTGAGAACTCGAGTTCTCAAAGTACACCTCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000803    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004383.x-2117s1c1
Sequence:CCGGAGAAAGAAAGTACCCAGCAAACTCGAGTTTGCTGGGTACTTTCTTTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004383.x-633s1c1
Sequence:CCGGGTACCAAACTCAGCCTCATGCCTCGAGGCATGAGGCTGAGTTTGGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004383.x-1077s1c1
Sequence:CCGGAGTGCATTAAGAACGACGCCACTCGAGTGGCGTCGTTCTTAATGCACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004383
VALIDATED
CSK MISSION shRNA shRNA Plasmid DNA
c-src tyrosine kinase
Human
22 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000342288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004383.2-1125s21c1
Sequence:CCGGCGAGGAGGTGTACTTTGAGAACTCGAGTTCTCAAAGTACACCTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004383.2-1166s21c1
Sequence:CCGGACTACACCTCAGACGCAGATGCTCGAGCATCTGCGTCTGAGGTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004383.2-1193s21c1
Sequence:CCGGGTACGCGCCTCATTAAACCAACTCGAGTTGGTTTAATGAGGCGCGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004383.2-1938s21c1
Sequence:CCGGGCCCGCAGTCTATGAAGTCATCTCGAGATGACTTCATAGACTGCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004383.2-1900s21c1
Sequence:CCGGGAGAAGGGCTACAAGATGGATCTCGAGATCCATCTTGTAGCCCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004383.1-592s1c1
Sequence:CCGGCCCAGCCAACTACGTCCAGAACTCGAGTTCTGGACGTAGTTGGCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004383.1-1538s1c1
Sequence:CCGGCTCTGGGAAATCTACTCCTTTCTCGAGAAAGGAGTAGATTTCCCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199031    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004383.1-1916s1c1
Sequence:CCGGCCGTCTCTCTTGGACCCACCTCTCGAGAGGTGGGTCCAAGAGAGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199755    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004383.1-1121s1c1
Sequence:CCGGGCCTCAGTCATGACGCAACTGCTCGAGCAGTTGCGTCATGACTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199611    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004383.1-1034s1c1
Sequence:CCGGGACGTGATGCTGGGCGATTACCTCGAGGTAATCGCCCAGCATCACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004383.1-1503s1c1
Sequence:CCGGCCACTAAGTCTGACGTGTGGACTCGAGTCCACACGTCAGACTTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004383.1-1648s1c1
Sequence:CCGGGCCCGCAGTCTATGAAGTCATCTCGAGATGACTTCATAGACTGCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004383.x-1057s1c1
Sequence:CCGGAGGGAACAAAGTCGCCGTCAACTCGAGTTGACGGCGACTTTGTTCCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004383.x-876s1c1
Sequence:CCGGACTACACCTCAGACGCAGATGCTCGAGCATCTGCGTCTGAGGTGTAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004383.x-903s1c1
Sequence:CCGGGTACGCGCCTCATTAAACCAACTCGAGTTGGTTTAATGAGGCGCGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004383.x-1079s1c1
Sequence:CCGGTGCATTAAGAACGACGCCACTCTCGAGAGTGGCGTCGTTCTTAATGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004383.x-1610s1c1
Sequence:CCGGGAGAAGGGCTACAAGATGGATCTCGAGATCCATCTTGTAGCCCTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004383.x-1280s1c1
Sequence:CCGGTGTCTCCTCAAGTTCTCGCTACTCGAGTAGCGAGAACTTGAGGAGACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004383.x-835s1c1
Sequence:CCGGCGAGGAGGTGTACTTTGAGAACTCGAGTTCTCAAAGTACACCTCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000803    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004383.x-2117s1c1
Sequence:CCGGAGAAAGAAAGTACCCAGCAAACTCGAGTTTGCTGGGTACTTTCTTTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004383.x-633s1c1
Sequence:CCGGGTACCAAACTCAGCCTCATGCCTCGAGGCATGAGGCTGAGTTTGGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004383.x-1077s1c1
Sequence:CCGGAGTGCATTAAGAACGACGCCACTCGAGTGGCGTCGTTCTTAATGCACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004383
VALIDATED
CSK MISSION shRNA Lentiviral Transduction Particles
c-src tyrosine kinase
Human
22 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000342288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004383.2-1125s21c1
Sequence:CCGGCGAGGAGGTGTACTTTGAGAACTCGAGTTCTCAAAGTACACCTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004383.2-1166s21c1
Sequence:CCGGACTACACCTCAGACGCAGATGCTCGAGCATCTGCGTCTGAGGTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004383.2-1193s21c1
Sequence:CCGGGTACGCGCCTCATTAAACCAACTCGAGTTGGTTTAATGAGGCGCGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004383.2-1938s21c1
Sequence:CCGGGCCCGCAGTCTATGAAGTCATCTCGAGATGACTTCATAGACTGCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004383.2-1900s21c1
Sequence:CCGGGAGAAGGGCTACAAGATGGATCTCGAGATCCATCTTGTAGCCCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004383.1-592s1c1
Sequence:CCGGCCCAGCCAACTACGTCCAGAACTCGAGTTCTGGACGTAGTTGGCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004383.1-1538s1c1
Sequence:CCGGCTCTGGGAAATCTACTCCTTTCTCGAGAAAGGAGTAGATTTCCCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199031    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004383.1-1916s1c1
Sequence:CCGGCCGTCTCTCTTGGACCCACCTCTCGAGAGGTGGGTCCAAGAGAGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199755    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004383.1-1121s1c1
Sequence:CCGGGCCTCAGTCATGACGCAACTGCTCGAGCAGTTGCGTCATGACTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199611    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004383.1-1034s1c1
Sequence:CCGGGACGTGATGCTGGGCGATTACCTCGAGGTAATCGCCCAGCATCACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004383.1-1503s1c1
Sequence:CCGGCCACTAAGTCTGACGTGTGGACTCGAGTCCACACGTCAGACTTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004383.1-1648s1c1
Sequence:CCGGGCCCGCAGTCTATGAAGTCATCTCGAGATGACTTCATAGACTGCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004383.x-1057s1c1
Sequence:CCGGAGGGAACAAAGTCGCCGTCAACTCGAGTTGACGGCGACTTTGTTCCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004383.x-876s1c1
Sequence:CCGGACTACACCTCAGACGCAGATGCTCGAGCATCTGCGTCTGAGGTGTAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004383.x-903s1c1
Sequence:CCGGGTACGCGCCTCATTAAACCAACTCGAGTTGGTTTAATGAGGCGCGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004383.x-1079s1c1
Sequence:CCGGTGCATTAAGAACGACGCCACTCTCGAGAGTGGCGTCGTTCTTAATGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004383.x-1610s1c1
Sequence:CCGGGAGAAGGGCTACAAGATGGATCTCGAGATCCATCTTGTAGCCCTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004383.x-1280s1c1
Sequence:CCGGTGTCTCCTCAAGTTCTCGCTACTCGAGTAGCGAGAACTTGAGGAGACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004383.x-835s1c1
Sequence:CCGGCGAGGAGGTGTACTTTGAGAACTCGAGTTCTCAAAGTACACCTCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000803    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004383.x-2117s1c1
Sequence:CCGGAGAAAGAAAGTACCCAGCAAACTCGAGTTTGCTGGGTACTTTCTTTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004383.x-633s1c1
Sequence:CCGGGTACCAAACTCAGCCTCATGCCTCGAGGCATGAGGCTGAGTTTGGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004383.x-1077s1c1
Sequence:CCGGAGTGCATTAAGAACGACGCCACTCGAGTGGCGTCGTTCTTAATGCACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks