EMAIL THIS PAGE TO A FRIEND

CSMD1

CUB and Sushi multiple domains 1

73 Gene Product Result for
Synonyms: PPP1R24
UniProtKB ID: Q96PZ7, Q0H0J5, Q96QU9, Q96RM4
Gene ID:
Mouse(94109) CUB and Sushi multiple domains 1
Rat(364634) CUB and Sushi multiple domains 1
Zebrafish(100534721) CUB and Sushi multiple domains 1
cow(526825) CUB and Sushi multiple domains 1
dog(100683465) CUB and Sushi multiple domains 1
Horse(100064581) CUB and Sushi multiple domains 1
domestic cat(101082560) CUB and Sushi multiple domains 1
chicken(421899) CUB and Sushi multiple domains 1
sheep(101103122) CUB and Sushi multiple domains 1
domestic guinea pig(100721483) CUB and Sushi multiple domains 1
naked mole-rat(101716256) CUB and Sushi multiple domains 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033225 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033225 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033225 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_053171 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053171 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053171 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033225 Rosetta Predictions human pricing
NM_001037327 Rosetta Predictions rat pricing
NM_053171 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033225 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00075434 predicted 2592
2 SASI_Hs01_00075435 predicted 2970
3 SASI_Hs01_00075436 predicted 10522
4 SASI_Hs02_00361024 predicted 8910
5 SASI_Hs01_00075438 predicted 6900
6 SASI_Hs02_00361025 predicted 6676
7 SASI_Hs01_00075439 predicted 2154
8 SASI_Hs01_00075442 predicted 7899
9 SASI_Hs01_00075443 predicted 860
10 SASI_Hs02_00361026 predicted 11174
11 SASI_Hs01_00075437 predicted 1151
12 SASI_Hs01_00075440 predicted 2214
13 SASI_Hs01_00075441 predicted 8282
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037327 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00054044 predicted 5819
2 SASI_Rn01_00054045 predicted 7091
3 SASI_Rn01_00054047 predicted 5807
4 SASI_Rn01_00054048 predicted 2973
5 SASI_Rn01_00054049 predicted 7342
6 SASI_Rn02_00204366 predicted 3388
7 SASI_Rn01_00054050 predicted 7418
8 SASI_Rn01_00054051 predicted 1301
9 SASI_Rn01_00054052 predicted 3605
10 SASI_Rn01_00054053 predicted 3489
11 SASI_Rn01_00054046 predicted 3504
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053171 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00337727 predicted 5831
2 SASI_Mm01_00147523 predicted 1682
3 SASI_Mm02_00337728 predicted 10083
4 SASI_Mm01_00147524 predicted 5324
5 SASI_Mm01_00147525 predicted 2232
6 SASI_Mm01_00147526 predicted 6197
7 SASI_Mm02_00337729 predicted 10983
8 SASI_Mm01_00147527 predicted 895
9 SASI_Mm01_00147528 predicted 3335
10 SASI_Mm01_00147530 predicted 3873
11 SASI_Mm01_00147522 predicted 7858
12 SASI_Mm01_00147529 predicted 7688
13 SASI_Mm01_00147531 predicted 7011
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033225
CSMD1 MISSION shRNA Bacterial Glycerol Stock
CUB and Sushi multiple domains 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033225.5-8124s21c1
Sequence:CCGGTGAGTACGGTGCTCAAGTATTCTCGAGAATACTTGAGCACCGTACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033225.5-10154s21c1
Sequence:CCGGGCACCTGCCTTGCCAATTTAACTCGAGTTAAATTGGCAAGGCAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005991    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033225.3-11313s1c1
Sequence:CCGGCCTGGCTGCATCTGTATGAAACTCGAGTTTCATACAGATGCAGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033225.3-11002s1c1
Sequence:CCGGCCCATGTATGATACAAACTTACTCGAGTAAGTTTGTATCATACATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033225.3-10013s1c1
Sequence:CCGGCCTGCATTGATCCTGCTCATACTCGAGTATGAGCAGGATCAATGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033225.3-778s1c1
Sequence:CCGGGCCCAAGGTTTCAAAGCATTACTCGAGTAATGCTTTGAAACCTTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033225.3-5411s1c1
Sequence:CCGGCCCTGAATGATTTGGCAGAATCTCGAGATTCTGCCAAATCATTCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033225
CSMD1 MISSION shRNA shRNA Plasmid DNA
CUB and Sushi multiple domains 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033225.5-8124s21c1
Sequence:CCGGTGAGTACGGTGCTCAAGTATTCTCGAGAATACTTGAGCACCGTACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033225.5-10154s21c1
Sequence:CCGGGCACCTGCCTTGCCAATTTAACTCGAGTTAAATTGGCAAGGCAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005991    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033225.3-11313s1c1
Sequence:CCGGCCTGGCTGCATCTGTATGAAACTCGAGTTTCATACAGATGCAGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033225.3-11002s1c1
Sequence:CCGGCCCATGTATGATACAAACTTACTCGAGTAAGTTTGTATCATACATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033225.3-10013s1c1
Sequence:CCGGCCTGCATTGATCCTGCTCATACTCGAGTATGAGCAGGATCAATGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033225.3-778s1c1
Sequence:CCGGGCCCAAGGTTTCAAAGCATTACTCGAGTAATGCTTTGAAACCTTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033225.3-5411s1c1
Sequence:CCGGCCCTGAATGATTTGGCAGAATCTCGAGATTCTGCCAAATCATTCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033225
CSMD1 MISSION shRNA Lentiviral Transduction Particles
CUB and Sushi multiple domains 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033225.5-8124s21c1
Sequence:CCGGTGAGTACGGTGCTCAAGTATTCTCGAGAATACTTGAGCACCGTACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033225.5-10154s21c1
Sequence:CCGGGCACCTGCCTTGCCAATTTAACTCGAGTTAAATTGGCAAGGCAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005991    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033225.3-11313s1c1
Sequence:CCGGCCTGGCTGCATCTGTATGAAACTCGAGTTTCATACAGATGCAGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033225.3-11002s1c1
Sequence:CCGGCCCATGTATGATACAAACTTACTCGAGTAAGTTTGTATCATACATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033225.3-10013s1c1
Sequence:CCGGCCTGCATTGATCCTGCTCATACTCGAGTATGAGCAGGATCAATGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033225.3-778s1c1
Sequence:CCGGGCCCAAGGTTTCAAAGCATTACTCGAGTAATGCTTTGAAACCTTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033225.3-5411s1c1
Sequence:CCGGCCCTGAATGATTTGGCAGAATCTCGAGATTCTGCCAAATCATTCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053171
CSMD1 MISSION shRNA Bacterial Glycerol Stock
CUB and Sushi multiple domains 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101370    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053171.1-11039s1c1
Sequence:CCGGCCTCTGATGGACAAGCAGTAACTCGAGTTACTGCTTGTCCATCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053171.1-1589s1c1
Sequence:CCGGCCCAGTGCAATATGAAGACAACTCGAGTTGTCTTCATATTGCACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053171.1-1590s1c1
Sequence:CCGGCCAGTGCAATATGAAGACAATCTCGAGATTGTCTTCATATTGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053171.1-6887s1c1
Sequence:CCGGCGAGGCTGTAAATGACTACATCTCGAGATGTAGTCATTTACAGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053171.1-2223s1c1
Sequence:CCGGGCCGTCAAAGATGATGGGATTCTCGAGAATCCCATCATCTTTGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053171
CSMD1 MISSION shRNA shRNA Plasmid DNA
CUB and Sushi multiple domains 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101370    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053171.1-11039s1c1
Sequence:CCGGCCTCTGATGGACAAGCAGTAACTCGAGTTACTGCTTGTCCATCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053171.1-1589s1c1
Sequence:CCGGCCCAGTGCAATATGAAGACAACTCGAGTTGTCTTCATATTGCACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053171.1-1590s1c1
Sequence:CCGGCCAGTGCAATATGAAGACAATCTCGAGATTGTCTTCATATTGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053171.1-6887s1c1
Sequence:CCGGCGAGGCTGTAAATGACTACATCTCGAGATGTAGTCATTTACAGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053171.1-2223s1c1
Sequence:CCGGGCCGTCAAAGATGATGGGATTCTCGAGAATCCCATCATCTTTGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053171
CSMD1 MISSION shRNA Lentiviral Transduction Particles
CUB and Sushi multiple domains 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101370    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053171.1-11039s1c1
Sequence:CCGGCCTCTGATGGACAAGCAGTAACTCGAGTTACTGCTTGTCCATCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053171.1-1589s1c1
Sequence:CCGGCCCAGTGCAATATGAAGACAACTCGAGTTGTCTTCATATTGCACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053171.1-1590s1c1
Sequence:CCGGCCAGTGCAATATGAAGACAATCTCGAGATTGTCTTCATATTGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053171.1-6887s1c1
Sequence:CCGGCGAGGCTGTAAATGACTACATCTCGAGATGTAGTCATTTACAGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053171.1-2223s1c1
Sequence:CCGGGCCGTCAAAGATGATGGGATTCTCGAGAATCCCATCATCTTTGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks