EMAIL THIS PAGE TO A FRIEND

CSMD2

CUB and Sushi multiple domains 2

32 Gene Product Result for
Synonyms: dJ1007G16.1 dJ1007G16.2 dJ947L8.1
Gene ID:
Mouse(329942) CUB and Sushi multiple domains 2
Rat(313040) CUB and Sushi multiple domains 2
naked mole-rat(101707590) CUB and Sushi multiple domains 2
domestic guinea pig(101787879) CUB and Sushi multiple domains 2
sheep(101114234) CUB and Sushi multiple domains 2
Zebrafish(565460) CUB and Sushi multiple domains 2
cow(100139189) CUB and Sushi multiple domains 2
Horse(100069927) CUB and Sushi multiple domains 2
domestic cat(101084557) CUB and Sushi multiple domains 2
chicken(419640) CUB and Sushi multiple domains 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_052896 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052896 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052896 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU100161 MISSION® esiRNA esiRNA human CSMD2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052896 Rosetta Predictions human pricing
XM_232753 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052896 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00154281 predicted 1359
2 SASI_Hs01_00154283 predicted 5140
3 SASI_Hs01_00154284 predicted 8921
4 SASI_Hs02_00361630 predicted 8968
5 SASI_Hs02_00361631 predicted 3688
6 SASI_Hs01_00154285 predicted 7044
7 SASI_Hs01_00154287 predicted 2593
8 SASI_Hs01_00154288 predicted 1451
9 SASI_Hs01_00154289 predicted 4457
10 SASI_Hs01_00154290 predicted 6447
11 SASI_Hs01_00154282 predicted 6236
12 SASI_Hs01_00154286 predicted 3904
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_232753 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00161427 predicted 1563
2 SASI_Rn01_00161428 predicted 234
3 SASI_Rn01_00161429 predicted 927
4 SASI_Rn01_00161430 predicted 611
5 SASI_Rn01_00161431 predicted 515
6 SASI_Rn01_00161432 predicted 789
7 SASI_Rn01_00161433 predicted 1188
8 SASI_Rn01_00161434 predicted 480
9 SASI_Rn01_00161435 predicted 2342
10 SASI_Rn01_00161436 predicted 623
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052896
CSMD2 MISSION shRNA Bacterial Glycerol Stock
CUB and Sushi multiple domains 2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000162396    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_052896.2-12437s1c1
Sequence:CCGGCCCAATTTCTTATGCTCCCTTCTCGAGAAGGGAGCATAAGAAATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159957    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052896.2-7242s1c1
Sequence:CCGGGAGAAGCAATATGATGAGTTTCTCGAGAAACTCATCATATTGCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160506    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_052896.2-12563s1c1
Sequence:CCGGCCTTGTAAAGTTCCATGAGATCTCGAGATCTCATGGAACTTTACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159379    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_052896.2-11572s1c1
Sequence:CCGGGCAAAGGTAAAGACAGAGTTACTCGAGTAACTCTGTCTTTACCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159534    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052896.2-7241s1c1
Sequence:CCGGCGAGAAGCAATATGATGAGTTCTCGAGAACTCATCATATTGCTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161280    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052896.2-2878s1c1
Sequence:CCGGGCACCTGGATTATCGAAACATCTCGAGATGTTTCGATAATCCAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052896
CSMD2 MISSION shRNA shRNA Plasmid DNA
CUB and Sushi multiple domains 2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000162396    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_052896.2-12437s1c1
Sequence:CCGGCCCAATTTCTTATGCTCCCTTCTCGAGAAGGGAGCATAAGAAATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159957    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052896.2-7242s1c1
Sequence:CCGGGAGAAGCAATATGATGAGTTTCTCGAGAAACTCATCATATTGCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160506    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_052896.2-12563s1c1
Sequence:CCGGCCTTGTAAAGTTCCATGAGATCTCGAGATCTCATGGAACTTTACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159379    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_052896.2-11572s1c1
Sequence:CCGGGCAAAGGTAAAGACAGAGTTACTCGAGTAACTCTGTCTTTACCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159534    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052896.2-7241s1c1
Sequence:CCGGCGAGAAGCAATATGATGAGTTCTCGAGAACTCATCATATTGCTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161280    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052896.2-2878s1c1
Sequence:CCGGGCACCTGGATTATCGAAACATCTCGAGATGTTTCGATAATCCAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052896
CSMD2 MISSION shRNA Lentiviral Transduction Particles
CUB and Sushi multiple domains 2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000162396    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_052896.2-12437s1c1
Sequence:CCGGCCCAATTTCTTATGCTCCCTTCTCGAGAAGGGAGCATAAGAAATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159957    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052896.2-7242s1c1
Sequence:CCGGGAGAAGCAATATGATGAGTTTCTCGAGAAACTCATCATATTGCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160506    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_052896.2-12563s1c1
Sequence:CCGGCCTTGTAAAGTTCCATGAGATCTCGAGATCTCATGGAACTTTACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159379    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_052896.2-11572s1c1
Sequence:CCGGGCAAAGGTAAAGACAGAGTTACTCGAGTAACTCTGTCTTTACCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159534    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052896.2-7241s1c1
Sequence:CCGGCGAGAAGCAATATGATGAGTTCTCGAGAACTCATCATATTGCTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161280    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052896.2-2878s1c1
Sequence:CCGGGCACCTGGATTATCGAAACATCTCGAGATGTTTCGATAATCCAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks