EMAIL THIS PAGE TO A FRIEND

CSMD3

CUB and Sushi multiple domains 3

UniProtKB ID: Q7Z407, Q96PZ3
Gene ID:
Mouse(239420) CUB and Sushi multiple domains 3
Rat(314942) CUB and Sushi multiple domains 3
chicken(420279) CUB and Sushi multiple domains 3
dog(482016) CUB and Sushi multiple domains 3
Horse(100056748) CUB and Sushi multiple domains 3
cow(100125936) CUB and Sushi multiple domains 3
cow(538362) CUB and sushi domain-containing protein 3-like
sheep(101116738) CUB and Sushi multiple domains 3
domestic guinea pig(100725270) CUB and Sushi multiple domains 3
naked mole-rat(101700553) CUB and Sushi multiple domains 3
243 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_484467 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_484467 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_484467 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_052900 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052900 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052900 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081391 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081391 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081391 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052900 Rosetta Predictions human pricing
NM_198123 Rosetta Predictions human pricing
NM_198124 Rosetta Predictions human pricing
XM_001063057 Rosetta Predictions rat pricing
XM_001063107 Rosetta Predictions rat pricing
XM_001063165 Rosetta Predictions rat pricing
XM_001063221 Rosetta Predictions rat pricing
XM_235273 Rosetta Predictions rat pricing
NM_001081391 Rosetta Predictions mouse pricing
XM_974928 Rosetta Predictions mouse pricing
XM_975009 Rosetta Predictions mouse pricing
XM_975085 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052900 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00361636 predicted 4694
2 SASI_Hs01_00132114 predicted 10188
3 SASI_Hs01_00132115 predicted 3830
4 SASI_Hs02_00361637 predicted 8310
5 SASI_Hs02_00361638 predicted 6916
6 SASI_Hs01_00132117 predicted 7522
7 SASI_Hs01_00132119 predicted 3412
8 SASI_Hs02_00361639 predicted 10632
9 SASI_Hs02_00361640 predicted 4121
10 SASI_Hs01_00132122 predicted 2043
11 SASI_Hs01_00132116 predicted 4713
12 SASI_Hs01_00132118 predicted 5521
13 SASI_Hs01_00132120 predicted 2857
14 SASI_Hs01_00132121 predicted 2589
15 SASI_Hs01_00132123 predicted 4538
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198123 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00371654 predicted 5014
2 SASI_Hs01_00194823 predicted 10692
3 SASI_Hs01_00194824 predicted 4142
4 SASI_Hs02_00371655 predicted 4546
5 SASI_Hs02_00371656 predicted 8819
6 SASI_Hs02_00371657 predicted 7236
7 SASI_Hs01_00194826 predicted 7837
8 SASI_Hs01_00194828 predicted 3728
9 SASI_Hs02_00371658 predicted 11140
10 SASI_Hs02_00371659 predicted 4432
11 SASI_Hs01_00194825 predicted 5028
12 SASI_Hs01_00194827 predicted 5837
13 SASI_Hs01_00194829 predicted 3171
14 SASI_Hs01_00194830 predicted 2895
15 SASI_Hs01_00194831 predicted 2367
16 SASI_Hs01_00194832 predicted 4849
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198124 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00371660 predicted 4905
2 SASI_Hs01_00125364 predicted 10588
3 SASI_Hs01_00125365 predicted 4025
4 SASI_Hs02_00371661 predicted 8710
5 SASI_Hs02_00371662 predicted 7119
6 SASI_Hs01_00125367 predicted 7723
7 SASI_Hs01_00125369 predicted 3618
8 SASI_Hs02_00371663 predicted 11029
9 SASI_Hs02_00371664 predicted 4323
10 SASI_Hs01_00125372 predicted 2252
11 SASI_Hs01_00125366 predicted 4915
12 SASI_Hs01_00125368 predicted 5720
13 SASI_Hs01_00125370 predicted 3061
14 SASI_Hs01_00125371 predicted 2787
15 SASI_Hs01_00125373 predicted 4742
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063057 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00305602 predicted 1418
2 SASI_Rn02_00305603 predicted 2914
3 SASI_Rn02_00305604 predicted 10363
4 SASI_Rn02_00305605 predicted 234
5 SASI_Rn02_00305606 predicted 992
6 SASI_Rn02_00305607 predicted 7127
7 SASI_Rn02_00305608 predicted 5598
8 SASI_Rn02_00305609 predicted 5274
9 SASI_Rn02_00305610 predicted 803
10 SASI_Rn02_00305611 predicted 10204
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063107 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00305806 predicted 1420
2 SASI_Rn02_00305807 predicted 2911
3 SASI_Rn02_00305808 predicted 10363
4 SASI_Rn02_00305809 predicted 237
5 SASI_Rn02_00305810 predicted 994
6 SASI_Rn02_00305811 predicted 7126
7 SASI_Rn02_00305812 predicted 5596
8 SASI_Rn02_00305813 predicted 5276
9 SASI_Rn02_00305814 predicted 810
10 SASI_Rn02_00305815 predicted 10202
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063165 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00306057 predicted 1416
2 SASI_Rn02_00306058 predicted 2907
3 SASI_Rn02_00306059 predicted 10190
4 SASI_Rn02_00306060 predicted 239
5 SASI_Rn02_00306061 predicted 996
6 SASI_Rn02_00306062 predicted 5597
7 SASI_Rn02_00306063 predicted 5277
8 SASI_Rn02_00306064 predicted 6437
9 SASI_Rn02_00306065 predicted 805
10 SASI_Rn02_00306066 predicted 10008
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063221 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00306287 predicted 1720
2 SASI_Rn02_00306288 predicted 3209
3 SASI_Rn02_00306289 predicted 10687
4 SASI_Rn02_00306290 predicted 236
5 SASI_Rn02_00306291 predicted 989
6 SASI_Rn02_00306292 predicted 5891
7 SASI_Rn02_00306293 predicted 5573
8 SASI_Rn02_00306294 predicted 6737
9 SASI_Rn02_00306295 predicted 802
10 SASI_Rn02_00306296 predicted 10504
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_235273 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00124282 predicted 1560
2 SASI_Rn01_00124283 predicted 3255
3 SASI_Rn01_00124284 predicted 1316
4 SASI_Rn01_00124285 predicted 828
5 SASI_Rn01_00124286 predicted 7474
6 SASI_Rn01_00124287 predicted 1731
7 SASI_Rn01_00124288 predicted 5935
8 SASI_Rn01_00124289 predicted 638
9 SASI_Rn01_00124290 predicted 4120
10 SASI_Rn01_00124291 predicted 4166
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081391 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297941 predicted 6615
2 SASI_Mm02_00297942 predicted 1410
3 SASI_Mm02_00297943 predicted 3440
4 SASI_Mm02_00297944 predicted 9605
5 SASI_Mm02_00297945 predicted 10027
6 SASI_Mm02_00297946 predicted 726
7 SASI_Mm02_00297947 predicted 2088
8 SASI_Mm02_00297948 predicted 5647
9 SASI_Mm02_00297949 predicted 5508
10 SASI_Mm02_00297950 predicted 4046
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_974928 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00254925 predicted 6385
2 SASI_Mm01_00254926 predicted 1182
3 SASI_Mm01_00254927 predicted 3218
4 SASI_Mm01_00254928 predicted 9381
5 SASI_Mm01_00254929 predicted 9803
6 SASI_Mm01_00254930 predicted 495
7 SASI_Mm01_00254931 predicted 1858
8 SASI_Mm01_00254932 predicted 5276
9 SASI_Mm01_00254933 predicted 3817
10 SASI_Mm01_00254934 predicted 4357
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_975009 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00222047 predicted 436
2 SASI_Mm01_00222048 predicted 821
3 SASI_Mm01_00222049 predicted 850
4 SASI_Mm01_00222050 predicted 243
5 SASI_Mm01_00222051 predicted 551
6 SASI_Mm01_00222052 predicted 1344
7 SASI_Mm01_00222053 predicted 806
8 SASI_Mm01_00222054 predicted 1429
9 SASI_Mm01_00222055 predicted 455
10 SASI_Mm01_00222056 predicted 1392
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_975085 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00235093 predicted 7095
2 SASI_Mm01_00235094 predicted 6398
3 SASI_Mm01_00235095 predicted 3219
4 SASI_Mm01_00235096 predicted 9189
5 SASI_Mm01_00235097 predicted 243
6 SASI_Mm01_00235098 predicted 9615
7 SASI_Mm01_00235099 predicted 809
8 SASI_Mm01_00235100 predicted 1864
9 SASI_Mm01_00235101 predicted 5278
10 SASI_Mm01_00235102 predicted 3830
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_484467
CSMD3 MISSION shRNA Bacterial Glycerol Stock
CUB and Sushi multiple domains 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000087303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484467.2-938s1c1
Sequence:CCGGGCATAGCCAATTCGGTTAATACTCGAGTATTAACCGAATTGGCTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484467.2-574s1c1
Sequence:CCGGGCAGAAGAACGAAATAGAATACTCGAGTATTCTATTTCGTTCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484467.2-135s1c1
Sequence:CCGGGCTGGATAGGGTGATTGCATACTCGAGTATGCAATCACCCTATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484467.2-887s1c1
Sequence:CCGGGCTACAGCTGTGTAACTGGATCTCGAGATCCAGTTACACAGCTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484467.2-772s1c1
Sequence:CCGGGCTCACGGATTTAAAGTATATCTCGAGATATACTTTAAATCCGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_484467
CSMD3 MISSION shRNA shRNA Plasmid DNA
CUB and Sushi multiple domains 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000087303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484467.2-938s1c1
Sequence:CCGGGCATAGCCAATTCGGTTAATACTCGAGTATTAACCGAATTGGCTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484467.2-574s1c1
Sequence:CCGGGCAGAAGAACGAAATAGAATACTCGAGTATTCTATTTCGTTCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484467.2-135s1c1
Sequence:CCGGGCTGGATAGGGTGATTGCATACTCGAGTATGCAATCACCCTATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484467.2-887s1c1
Sequence:CCGGGCTACAGCTGTGTAACTGGATCTCGAGATCCAGTTACACAGCTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484467.2-772s1c1
Sequence:CCGGGCTCACGGATTTAAAGTATATCTCGAGATATACTTTAAATCCGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_484467
CSMD3 MISSION shRNA Lentiviral Transduction Particles
CUB and Sushi multiple domains 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000087303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484467.2-938s1c1
Sequence:CCGGGCATAGCCAATTCGGTTAATACTCGAGTATTAACCGAATTGGCTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484467.2-574s1c1
Sequence:CCGGGCAGAAGAACGAAATAGAATACTCGAGTATTCTATTTCGTTCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484467.2-135s1c1
Sequence:CCGGGCTGGATAGGGTGATTGCATACTCGAGTATGCAATCACCCTATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484467.2-887s1c1
Sequence:CCGGGCTACAGCTGTGTAACTGGATCTCGAGATCCAGTTACACAGCTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484467.2-772s1c1
Sequence:CCGGGCTCACGGATTTAAAGTATATCTCGAGATATACTTTAAATCCGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052900
CSMD3 MISSION shRNA Bacterial Glycerol Stock
CUB and Sushi multiple domains 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052900.2-1099s1c1
Sequence:CCGGCCACCAATTATCAGCAACAAACTCGAGTTTGTTGCTGATAATTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052900.2-7220s1c1
Sequence:CCGGCCAATGAATTACGGCTAGATTCTCGAGAATCTAGCCGTAATTCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052900.2-5585s1c1
Sequence:CCGGCCATAGCAATTAGGTGTGAAACTCGAGTTTCACACCTAATTGCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147435    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052900.2-10829s1c1
Sequence:CCGGGCACATTTAGTTCACTGCTAACTCGAGTTAGCAGTGAACTAAATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052900.2-1843s21c1
Sequence:CCGGGATCCTGGTACACCCTTATATCTCGAGATATAAGGGTGTACCAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052900.2-4980s21c1
Sequence:CCGGCAGACTTGGAATGGATTATAACTCGAGTTATAATCCATTCCAAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052900.2-3571s21c1
Sequence:CCGGGGTGCATCTGCAACGAATAATCTCGAGATTATTCGTTGCAGATGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052900.2-6641s21c1
Sequence:CCGGTTCACGGAGTCAGTCGTAATTCTCGAGAATTACGACTGACTCCGTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052900
CSMD3 MISSION shRNA shRNA Plasmid DNA
CUB and Sushi multiple domains 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052900.2-1099s1c1
Sequence:CCGGCCACCAATTATCAGCAACAAACTCGAGTTTGTTGCTGATAATTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052900.2-7220s1c1
Sequence:CCGGCCAATGAATTACGGCTAGATTCTCGAGAATCTAGCCGTAATTCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052900.2-5585s1c1
Sequence:CCGGCCATAGCAATTAGGTGTGAAACTCGAGTTTCACACCTAATTGCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147435    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052900.2-10829s1c1
Sequence:CCGGGCACATTTAGTTCACTGCTAACTCGAGTTAGCAGTGAACTAAATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052900.2-1843s21c1
Sequence:CCGGGATCCTGGTACACCCTTATATCTCGAGATATAAGGGTGTACCAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052900.2-4980s21c1
Sequence:CCGGCAGACTTGGAATGGATTATAACTCGAGTTATAATCCATTCCAAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052900.2-3571s21c1
Sequence:CCGGGGTGCATCTGCAACGAATAATCTCGAGATTATTCGTTGCAGATGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052900.2-6641s21c1
Sequence:CCGGTTCACGGAGTCAGTCGTAATTCTCGAGAATTACGACTGACTCCGTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052900
CSMD3 MISSION shRNA Lentiviral Transduction Particles
CUB and Sushi multiple domains 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052900.2-1099s1c1
Sequence:CCGGCCACCAATTATCAGCAACAAACTCGAGTTTGTTGCTGATAATTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052900.2-7220s1c1
Sequence:CCGGCCAATGAATTACGGCTAGATTCTCGAGAATCTAGCCGTAATTCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052900.2-5585s1c1
Sequence:CCGGCCATAGCAATTAGGTGTGAAACTCGAGTTTCACACCTAATTGCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147435    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052900.2-10829s1c1
Sequence:CCGGGCACATTTAGTTCACTGCTAACTCGAGTTAGCAGTGAACTAAATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052900.2-1843s21c1
Sequence:CCGGGATCCTGGTACACCCTTATATCTCGAGATATAAGGGTGTACCAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052900.2-4980s21c1
Sequence:CCGGCAGACTTGGAATGGATTATAACTCGAGTTATAATCCATTCCAAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052900.2-3571s21c1
Sequence:CCGGGGTGCATCTGCAACGAATAATCTCGAGATTATTCGTTGCAGATGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052900.2-6641s21c1
Sequence:CCGGTTCACGGAGTCAGTCGTAATTCTCGAGAATTACGACTGACTCCGTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081391
CSMD3 MISSION shRNA Bacterial Glycerol Stock
CUB and Sushi multiple domains 3
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000251130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081391.2-350s21c1
Sequence:CCGGGCGAACTGTACATGGGTAATACTCGAGTATTACCCATGTACAGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251129    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081391.2-12211s21c1
Sequence:CCGGTTGACTAAAGAGGTACAATATCTCGAGATATTGTACCTCTTTAGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081391.2-144s21c1
Sequence:CCGGGCACGCGAAGATGCGCTAAATCTCGAGATTTAGCGCATCTTCGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081391.2-2081s21c1
Sequence:CCGGGATCCTGGCACACCGTTATATCTCGAGATATAACGGTGTGCCAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081391
CSMD3 MISSION shRNA shRNA Plasmid DNA
CUB and Sushi multiple domains 3
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000251130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081391.2-350s21c1
Sequence:CCGGGCGAACTGTACATGGGTAATACTCGAGTATTACCCATGTACAGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251129    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081391.2-12211s21c1
Sequence:CCGGTTGACTAAAGAGGTACAATATCTCGAGATATTGTACCTCTTTAGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081391.2-144s21c1
Sequence:CCGGGCACGCGAAGATGCGCTAAATCTCGAGATTTAGCGCATCTTCGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081391.2-2081s21c1
Sequence:CCGGGATCCTGGCACACCGTTATATCTCGAGATATAACGGTGTGCCAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081391
CSMD3 MISSION shRNA Lentiviral Transduction Particles
CUB and Sushi multiple domains 3
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000251130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081391.2-350s21c1
Sequence:CCGGGCGAACTGTACATGGGTAATACTCGAGTATTACCCATGTACAGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251129    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081391.2-12211s21c1
Sequence:CCGGTTGACTAAAGAGGTACAATATCTCGAGATATTGTACCTCTTTAGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081391.2-144s21c1
Sequence:CCGGGCACGCGAAGATGCGCTAAATCTCGAGATTTAGCGCATCTTCGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081391.2-2081s21c1
Sequence:CCGGGATCCTGGCACACCGTTATATCTCGAGATATAACGGTGTGCCAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks